Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine
Q: Choose the combination of answers that most accurately completes the statement. The nitrogen bases…
A: The thread-like structure that consists of the genetic information of the organism, located within…
Q: The Vitamin required for the synthesis of nucleic acid is: A) Tocoferorl B) Folic acid C)…
A: Vitamins are the substance that our body needs to develop and function. Vitamin A,D,E,K and B are…
Q: Write down the reactions of serine and arginine amino acids with carboxyl and amino groups.
A: Amino acids are the monomers of the macromolecule, proteins. Twenty different amino acids are…
Q: What is the main function of bile salts? Draw the structure of bile salts.
A: Bile salts are the detergent molecules synthesized by the liver cell and stored in the gallbladder.…
Q: The language of nucleic acids in DNA and RNA (choose all that apply)
A:
Q: Choose the combination of answers that most accurately completes the statement.The primary mode of…
A: The microbial control is of two types, chemical and physical. The use of chemicals in killing or…
Q: Which compound is inorganic
A: All the chemical compounds can be classified into an organic or inorganic compound. This…
Q: Write short answers. i. Why proteins lose their function upon change in their 3D structure?
A: Proteins are most abundant macromolecules that occurs in cells and parts of cells. They are…
Q: Which is not an essential amino acid? a. Tryptophan b. Threonine c. Histidine d. Cysteine
A: On the basis of nutritional requirement amino acids are divided into three groups:- 1) Non…
Q: Speculate on the properties of proteins and peptides if none of the common amino acids contained…
A: A protein is a complex substance that consists of amino acids residues joined by peptide bonds.
Q: what are the main types if nucleic acids
A: Nucleic acid was first discovered by Friedrich Miescher from the nuclei of the pus cells…
Q: 6. Which of the following statements concerning bile acids is incorrect? They are... a. Insoluble in…
A: Bile acids are steroid acids present in bile of mammals and vertebrates. These bile acids are…
Q: Use Seliwanoff's test to distinguish fructose and surcose. If not possible, provide a reason.
A: The Seliwanoffs test is a test that is used to distinguish between aldose and ketose sugar. Upon…
Q: Short Answer Questions Draw and name three different functional groups. Draw the basic structure of…
A: Biomolecules refer to carbon- based organic compound that are produced by a living organism. These…
Q: How are enzymes used in medicine?
A: Enzymes Enzymes are catalysts, which means they speed up chemical reactions. For thousands of years,…
Q: Explain how nucleotides joined into two chains from the strands of a DNA molecule
A: For all living creatures and even plants, DNA is essential. For the processes of inheritance,…
Q: The polysaccharide found in plant cell walls isa. glucose.b. starch.c. maltose.d. cellulose.
A: Biomolecules such as carbohydrates, lipids, proteins etc. are very essential for sustaining life.…
Q: In a tabular form enumerate the carbohydrates and its significance
A: Carbohydrates are the most abundant biomolecules in nature and it is the major source of energy in…
Q: What is the relationship between vitamin A and β carotene? (Hint: Look up the structures on the…
A: Beta-carotene is one of a group of red, orange and yellow pigments called carotenoids. Beta-carotene…
Q: Which is a disaccharide? O glucose O fructose O sucrose cellulose
A: Monosaccharides are the simplest carbohydrates; and are termed simple sugars. A disaccharide is the…
Q: classical method to check the quality of Nucleic Acid Product
A: It is most commonly used today to perform a quick assessment of the purity of nucleic acid samples.…
Q: Phospholipase responsible for the tissue damage after spider bite? a.A1 b.A2 c.D d.C
A: Phospholipase (PLA) is a lipolytic enzymes which cleaves the phospholipid substrates at specific…
Q: Which describes the basic structure of a fatty acid
A: Biomolecules are the biological molecules that are present inside the living organisms. These…
Q: Define the term Biomolecules b) name the biomolecules which contribute as fuels
A: Bioenergetics involves energy metabolism which is a quantitative study of energy transductions…
Q: Another name for a protein chain is polypeptide
A: Protein is an important macromolecule which have it's linear or primary, secondary, tertiary and…
Q: Does a flour dissolves in water
A: A solvent is a compound that dissolves a solution, leading to a solution. A solvent is typically a…
Q: what molecule is responsible for protein synthesis *
A: Proteins are polymers of amino acids, linked by amide/peptide bond with release of a water molecule.…
Q: Is beer is sugar
A: Yeast, grains, spices, and water are the main ingredients in beer. Despite the fact that sugar is…
Q: A few simple sugars attached together.
A: Question - A few simple sugars attached together.
Q: compare and contrast carbohydrates from lipids.
A: Introduction: Carbohydrates and lipids are macromolecules that are made up of carbon, hydrogen, and…
Q: DNA is a __________ which is made up of nucleotides
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Give reason why potato cubes when placed in water become firm and increase in size.
A: Osmosis is a process through which the movement of water takes place through a semi-permeable…
Q: Choose the combination of answers that most accurately completes the statement. A nucleotide…
A: Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA) are two main types of nucleic acid present in…
Q: Answer SIMPLE or CONJUGATED ENZYME. a. An enzyme that contains a carbohydrate portion b. An enzyme…
A: The enzymes which are made from proteins only are known as simple enzymes, for example - pepsin,…
Q: what molecule is responsible for protein synthesis
A: mRNA molecule is responsible for protein synthesis .After transcription mRNA molecule goes to…
Q: What is function of RNA and proteins.
A: Proteins are complex molecules. They play many crucial roles in the body metabolism. RNA…
Q: which is the name of the given monosaccharide? a. Aldotriose b.Ketotriose c. Ketotetrose d.…
A: Carbohydrates are important molecules for a living cell as it is the major source of energy.…
Q: explain how iodine reacts with starch to be useful as a test for identity
A: Starch is a form of carbohydrate that is present in plants. It generally consists of a mixture of…
Q: A physician orders a diet of 20 g of protein, 300 g of carbohydrate, and 80 g of fat. Calculate the…
A: Diet therapy has primary goals such as preventing nutritional deficiencies, maintaining normal blood…
Q: The covalent bond that joins amino acids together (once dehydration synthesis has occurred) is…
A: 9) option B) peptide bond The linking of two amino acids is accompanied by the loss of a molecule of…
Q: ademic) Hemoglobin is a protein that has a Structure. Answer:
A: Hemoglobin is a main oxygen carrying protein which is present in red blood cells
Q: Deduce the number of isomers of fructose
A: Two or more compounds which have same formula but different arrangement of atoms in the molecule and…
Q: Create a concept map employing the different chemical tests for the differentiation of the types of…
A: Carbohydrates are polyhydroxy alcohols which are derivatives of aldehydes and ketones which are…
Q: What is the name of the bond formed between adjacent amino acids in a protein? Question 34 options:…
A: Every amino acid is connected to another amino acid by a covalent bond, known as a peptide bond. At…
Q: identify an amino acid that contains a side chain that can form hydrogen bonds with water (complete…
A: Amino acids are the biomolecules that contains alpha-amino and alpha-carboxylic acid groups in its…
Q: Which statement accurately describes the differences between RNA and DNA? RNA always folds into a…
A: DNA or deoxyribonucleic acid is a long molecule that contains a unique genetic code. It is a…
Q: Design an experiment to show how you can use Benedict's solution to quantify the presence of a…
A: The application of scientific and technical principles to the processing of the material by agents…
Q: How monomers of protein differ from each other
A: Proteins are biomolecules and the body’s building blocks. They play significant roles in body…
Step by step
Solved in 3 steps
- w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’Туре of mutation: Effect: Original Altered protein/ amino acid sequence sequence DNA nucleotide MRNA AUUCGAGUA AUUCGGGUA amino acid MRNA ACGGAACCG ACGGUACCG amino acid MRNA GCUAGAAGU GCUUGAAGU amino acid MRNA GGCGCUACAUCA GGCAGCUACAUC A amino acid MRNA GGCGCUACAUCA GGGCUACAUCA amino acid-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
- Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: ATG CGC ТСС САТ стт ААС АAА GAG GTT GG C TAT TT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC ТАТ ТТT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense frame-shift silent antisenseGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
- Complete the complementary strand: mRNA transcription ATTCGAGGCTAAMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…