A mutation occurred in the DNA sequence during replication. Which of the following, A-D, describes the result of the mutation when the corresponding mRNA sequence is translated?

Q: What is meant by the semiconservative nature of DNA replication?

A: DNA replication is the process of producing daughter strands of DNA from parent strands by the…

Q: Answer the questions below to explain the Reproductive System- List 3 or more major organs/ parts…

A: The system which support the development and growth of baby is called reproductive system.

Q: In DNA replication, what is the primer composed of and whyare there leading and lagging strands?

A: DNA replication is a biological process that results in formation of exact copies of DNA which is…

Q: Several different nucleic acids are involved in the process of getting a protein produced from a…

A: Sense strand is that strand of DNA double helix which has the translatable protein code in the 5'-3'…

Q: How many replication forks are formed at the origin of replication?

A: The two strands of DNA separate to form two single strands that act as templates for the process of…

Q: What is The molecular mechanisms governing the initia-tion of DNA replication.

A: Initiation of DNA replication involves making the target DNA accessible to the enzymes and proteins…

Q: After the RNA primers are all removed, which

A: The act of copying a cell's DNA, or DNA replication, is no easy task. Your genome contains…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: During the process of transcription, a nucleotide was deleted from an mRNA sequence that coded for a…

A: In the DNA sequence of an individual, a mutation is a heritable alteration. Compared to the wild…

Q: Is the entire strand of DNA template strand of DNA transcribed at one time?  Explain answer

A: DNA is the genetic material in living organisms that is composed of polynucleotide strands. The…

Q: What would happen if any of the stages involved in the translation of DNA to protein were…

A: Translation is a process in which ribosomes synthesizes the proteins in Cytoplasm after the…

Q: in the process of DNA replication, what happens to its products when DNA polymerase 1 is not…

A: Dna replication is a process through which the amount of DNA is doubled . It is vary vital process…

Q: Explain how the lagging dna strand is copied during dna replication? What are the enzymes involved?

A: The nascent deoxyribonucleic acid (DNA) consists of one leading strand and one lagging strand.

Q: What would happen to DNA replication if there was a nonsense mutation in the gene that codes for…

A: Transcription is the process through which the enzyme RNA Polymerase transfers information from one…

Q: With regard to DNA replication, define the term bidirectional replication.

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: strand: (d) Specify the anticodon present on each of the transfer RNA's involved.

A: Deoxyribonucleic Acid (DNA) is a two-stranded biomolecule. It is a build-up of nucleotides. Distinct…

Q: During DNA replication, why do we have a leading and a lagging strand?

A: DNA replication is the cellular process by which cell produce to new daughter stand from two old…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…

A: DNA polymerase moves along the template strand in a 3'–5' direction, and the daughter strand is…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…

A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: Describe two ways by which DNA is released from cells.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: What types of subunits make up a single strand of DNA? How are the subunits linked?

A: Introduction  DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…

Q: Indicate whether there is matching (1) or base complementarity (2) between the following nucleic…

A: The template strand is also called antisense strand.  Biosynthesis of mRNA using antisense strand of…

Q: The enzyme required to open up the double stranded DNA during replication and form the replication…

A: The molecule found within cells contains the genetic information required for the development and…

Q: What is the first step of nucleosome formation during DNA replication?

A: The nucleosome is the basic level of chromosomal organization. The nucleosome consists of an octamer…

Q: Errors can occur in any of these processes when an incorrect nucleotide or amino acid is added…

A: The term DNA replication is associated with the process of duplicating DNA, which acts as the…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.