Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the lower DNA sequence (shown in bold font). This is an example of a mutation. DNA: АTG CGC ТСС САТ стT ААС ААA GAG GTT GGC TАТ TTT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe DNA: АTG CGC ТСС САТ стТ ААС АAG GAG GTT GGC TАТ ТTT Protein: Met-Arg-Ser-His-Leu-Asn-Lys-Glu-Ala-Gly-Tyr-Phe missense nonsense O frame-shift silent antisense оооо о

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: I have a presentation on the discovery of the genetic code, but I don't know how to organize my…

A: Presentation should start with a brief introduction about the genetic code. It should cover the most…

Q: Sickle cell anemia is caused by a point mutation in the β-globin chain of hemoglobin. Glutamic acid…

A: Introduction : Haemoglobin is a tetrameric proteinmade up of 2 alpha subunits and 2 beta subunits…

Q: RNA codon table 2nd position G 1st A 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Cys…

A: Three consecutive nitrogen base on mRNA is called genetic code which determine a specific amino…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are the linera chain of Amino acids Synthesised according to the codons on mRNA.…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with…

A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific sites i.e. at…

Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…

A: DNA replication being very complex process, there are chances of miss reading the DNA template and…

Q: Below is a primary sequence alignment between the wild-type hemoglobin protein, and the hemoglobin…

A: Hemoglobin can be described as a pigmented protein that forms a component of the red blood cells or…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…

A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: I was wondering if it is possible to provide an explanation on the structure of the PDB code 2V1X,…

A: Each PDB code represents a unique identifier for a particular protein structure. The PDB code is…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: An addition or deletion mutation that results in all of the amino acids after the mutation being…

A: A mutation refers to the sudden change in DNA (deoxyribonucleic acid) that subsequently affects the…

Q: Describe the term SDS-PAGE.

A: Charged particles migrate during electrophoresis under the influence of an electric current. For…

Q: Where does the process of transcription start on the strand of DNA?____        Where does the…

A: Transcription is that the process of creating an RNA copy of a gene sequence. This copy, called a…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…

A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT…

A: A small section of a gene for a protein has the following nucleotide sequence that codes for the…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: Simply put, what is DFR stand for?

A: In biochemistry, DRF can stand for different things depending on the context. Here are some…

Q: kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA…

A: Sickle cell anaemia is a inherent condition in which red blood cells are abnormally fickle shaped…

Q: What would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC?

A: The process of translation is essentially reading the message sent from DNA in the form of mRNA by…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D

A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: Name and explain the three possible consequences of having a mutation somewhere in the region from…

A: Mutations are the alterations in the nucleotide sequence of the genome of an organism that occurs…

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: Look at the amino acid chart below that the proctor placed on a board at the front of the classroom…

A: Sickle cell anemia is an inherited blood disorder that affects the structure and function of red…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: t the following DNA sequences to RNA sequences. Sequence # 1:…

A: Transcription is a process where the DNA is read and an mRNA transcript is synthesized. This mRNA…

Q: Translate the following mRNA: 5-A U G A A A U U U C U U U A G G U C G A A -3     NH3+-…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…

A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.