opic?? Experiment Protein Estimation. What is the standard curve equation for this BSA standard?

Q: From the following information determine the amino acid sequence of a peptide. N-terminal Edman…

A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…

Q: Need help, please. Answer choices are provided below for drop-down questions. 1. The overall charge…

A: The proteins or peptides are composed of twenty standard amino acids attached together via peptide…

Q: An Fab fragment binds to lysozyme with a dissociation constant of K4 = 10 M. A 1 nM (10 M) solution…

A: Consider the following reaction: where P is the protein, L is the ligand and k1 and k2 are rate…

Q: Pls help ASAP.

A: Transcription is the conversion of DNA into mRNA.  * The main difference between DNA and mRNA is…

Q: A 50.0 ml juice extract is colorimetrically assayed using Nelson's test. One milliliter (1.00 mL) of…

A: Nelson Somogyi Method: Reducing sugars are sugars that have a reducing property rendered by a…

Q: a. How are dental caries formed? What are the ways to prevent these? (Dental products)

A: The primary reason for tooth loss in both children and adults is dental caries. Both adults' and…

Q: A protein was supplied at 10mg/mL. It has a molecule weight of 40,000g/mol. Which of the following…

A: To determine the correct concentration(s) of the protein, we need to convert the given information…

Q: Based on the Agarose Gel Electrophoresis results, tell in which concentration range of KCl the…

A: Ion-exchange chromatography separates molecules based on their charge properties. Based on charge…

Q: Summarize the data below obtained from the protein experiments for determination of protein…

A: The principle of the Bradford assay is based on the fact that the absorbance maximum for an acidic…

Q: Please ASAP. Thank you. Explain these results in short answer form. Why was the slope zero for…

A: Peroxidase is the enzyme that catalyzes oxidation-reduction reactions by the use of free radicals…

Q: You fill a (fixed volume) dialysis bag with a solution of a protein (1 mM) in water, seal the…

A: Dialysis tubing can be defined as a semi permeable membrane tubing is particularly used in…

Q: the same Protein X was purified from tissue source A and tissue source B, yielding the following…

A: Introduction  Proteins are large biomolecules that play critical roles in almost all cellular…

Q: 9. The NUDT18 protein was purified by affinity chromatography (Hiss tagged) followed by gel…

A: Affinity chromatography is a method of separating a biomolecule from a mixture, based on its ability…

Q: E. coli BL21 cells carrying a pQE expression vector can be induced to produce large amounts of a…

A: Ans is f - glucose, E. coli BL21 Cells carrying a PQE expression vector can be induced by adding…

Q: QUESTION 5 Using SP-Sepharose as ion exhange resin, indicate the starting and ending pH for the…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: Thank you for helping me. I have to questions. In solution B, if we choose two other points on the…

A: Lineweaver Burk plot is used to determine the enzyme kinetics parameters like Km and Vmax. Vmax is…

Q: (Q21) A certain protein has a Ką value 107 M-1 and other has a Ką value of 10° M²1. Of two proteins,…

A: Ans True In order to determine the isoelectric point a given protein, we must follow a general rule…

Q: What is the importance of using multiple purification methods in isolating a protein?

A: Introduction  Proteins are substantial biomolecules and macromolecules made up of one or more…

Q: The gels we will be using for electrophoresis during the next lab consist of 1% agarose. Suppose you…

A: There are different ways to denote the concentration of a solution.  Per cent (w/v) means there is 1…

Q: Question 1 What type of a relation do we expect to get if we fix the enzyme concentration and look…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: Calmodulin dependent kinase 1 protein contains 14 tyrosine's 4 tryptophans and 6 phenylalanines the…

A: Introduction :- Calmodulin is a calcium-binding protein that plays a crucial role in regulating many…

Q: Explain the phenomena of the loop of Henle.

A: Loop Of Henle long U-shaped portion of the tubule that conducts urine within each nephron of the…

Q: 5. Using the scores in BLOSUM-62 matrix, and assuming the score of indel is -4, provide the score…

A: The term "indel" stands for "insertion/deletion", and it refers to the presence of gaps in the…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: Using the information in the table below, enter the correct pH that should be used to separate the…

A: Amino acids are organic compounds that contain an amino group (-NH2) and a carboxyl group (-COOH)…

Q: Enzymes work fastest at the start of a process and this is called (1). As the enzyme concentration…

A: The enzymes are the biocatalyst that speed up a biochemical reaction. At the end of the chemical…

Q: Application Refer to the table below to answer the following items. Base Percentage Source of DNA…

A: Source of DNA Adenine Guanine Cytosine Thymine Sea urchin 32.8 17.7 17.3 32.1 Salmon 29.7 20.8…

Q: Need help, please.

A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…

Q: What is meant by drug discovery. Describe the process by elaborating steps involved in drug…

A: Humans are organisms that require protection against several other organisms. The immune system is…

Q: What is the method of MS protein quantification presented here

A: MS protein quantification is the method used for protein quantification by LC–MS that help in…

Q: Need help, please.

A: MM kinetics describes the mathematical relation between initial rate of reaction(vo), maximum rate…

Q: You are about to assay for your LDH using LDH reaction cocktail. Your instructor tells you to dilute…

A: Supernatant refers to a clear solution located above the solid residues deposited after certain…

Q: molecular biochemical process occur in normal and disease of scurvy

A: Scurvy disease is due to lack of vitamin C (ascorbic acid). Symptoms of scurvy are- -weakness,…

Q: Which method can be used for structure prediction of “Harder Target” Proteins and Why? Also write…

A: Prediction of protein structures using bioinformatics can include sequence similarity searches,…

Q: Sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE) is used to identify the…

A: Electrophoretic separation of proteins is most commonly performed in polyacrylamide gels. The…

Q: RESTRICTION ENZYME MAPPING Predict the result

A: Restriction enzymes are those which cut DNA at a specific location called as restriction site.

Q: Practice test

A: Mutations in RNA sequence:a. Frameshift Mutation (2 marks):This mutation alters the reading frame by…

Q: firt imagine right side   An SDS-PAGE electrophoresis obtained after protein extraction is shown in…

A: SDS-PAGE gives a preview of the protein composition inside a sample by size division, while Western…

Q: 1. Proteoglycans, such as heparan sulfate are defined as having sulfated glycosaminoglycans that are…

A: Proteoglycans are highly glycosylated proteins. A "core protein" with one or more covalently bonded…

Q: A gene is transcribed in a fibroblast and a chondrocyte, but the primary structure of the encoded…

A:

Q: Protein databases with mass spectrometry analysis are not useful in proteomics studies due to the…

A: A mass spectrometer is a piece of experimental equipment that differentiates molecular ions in the…

Q: A team of R&D scientists were trying to make a "better" enzyme. A molecular biologist mutated ami…

A: With a 1-substrate enzyme, an equilibrium binding experiment cannot be done to measure Kd. This is…

Q: Another question about tecniques that im getting confused over  Can someone explain me which one…

A: Trypsin and chymotrypsin are protease enzymes that cleave the internal peptide bonds in a peptide.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.