What is the method of MS protein quantification presented here

Q: A mutant monkey was identified that showed resistance to a viral disease 'Kansah'. The kan gene,…

A: In molecular biology, PCR (polymerase chain reaction) plays an important role. With the help of this…

Q: 3) Enzyme assay. When cyclin D1 activates Cdk4 and Cdk6, the activated Cdks phosphorylate…

A: Cdk6 is the protein which regulates cell cycle with protein V and RB protein.

Q: 1. Which modification occurs as part of transcriptional termination? Explain this modification and…

A: 1 ) ANSWER The maturation of a eukaryotic mRNA from primary mrna transcript  involve many complex…

Q: Enzymes are specific. They are match up with a specific and particular reactant. During the…

A: Enzymes are protein molecules which consists of an active aite where substrate binds to catalyze the…

Q: A protein 'standard curve' is a graph showing how absorbance changes with the amount of protein True…

A: Proteins are biomolecules which is made up of aminoacids connected via peptide bonds. These are of…

Q: Which of the following statements describe disadvantages of the classical Sanger sequencing approach…

A: Since you have posted multiple questions, we will answer the first question for you. If you need any…

Q: need help writting a biological "title" for this lab report. I performed 5 labs which are PCR…

A: " bioinformatic analysis and the recombination techniques ".

Q: Describe instances when a DNA mutation would not alter the function of a protein. Describe instances…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: item is given example. as an

A: Transgenic organisms in agriculture :- Examples- Bt cotton, Bt brinjal. To obtain a transgenic…

Q: Exelain ? lobhot ib madulor ef INA, Porodeim ?

A: DNA, RNA, and protein are firmly related. DNA contains the data essential for encoding proteins,…

Q: molecular biology technique Gene cloning & identification  that have been used to study the  protein…

A: Molecular techniques are laboratory methods that manipulate and analyze DNA, RNA and proteins at the…

Q: You are trying to purify Protein 1 from a mix of 4 different proteins without denaturing the…

A: Ion exchange chromatography is a techniques that separates ions and polar molecules based on their…

Q: Why doesn't the CRISPR system cut the bacterium's own DNA, at the point in its genome where it…

A: CRISPR is an acronym for Clustered Regularly Interspaced Short Palindromic Repeat. This name refers…

Q: DNA RNA PROTEIN

A: The central dogma is a molecular biology process that converts DNA to RNA and creates a functioning…

Q: Please answer this quickly

A: The cells are of two types - prokaryotes and eukaryotes. Prokaryotes are primitive cells without any…

Q: Molecule X MMP-2 cleavable sequence Molecule Y

A: The imaging agent in the figure consists of two molecules - molecule X (donor) and molecule Y…

Q: The following is the PCR reaction that is programmed in the thermocycler to amplify the cheek cell…

A: Polymerase chain reaction (PCR) is a method that is used to amplify a selected region of DNA and…

Q: 6) * Earlier this semester (in the Class 1 Handout Practice Problems), we learned that individuals…

A: The body's immune system is in charge of warding off infection. It accomplishes this in a variety of…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…

A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…

Q: 8. Chaperones is/are useful in: a. Folding of protein b. Release of protein c. Denaturation of…

A: Chaperons are the proteins present in a wide range of species from bacteria to humans . They are…

Q: Why do you think DNA supercoiling is important to the ?bacterial cells

A: DNA replication is a process by which DNA is copied or replicate and pass on to its daughter cells.…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…

A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: Please help me with this question. More than one answer may be correct. THe graph relating to the…

A: The graphical representation illustrates the percentage of cells exhibiting clusters of IRE1…

Q: Question 5. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Introduction - The silencing complex is made up of short interfering RNA (siRNA), miRNA, and the…

Q: Need question 11 answered

A: During gene cloning, the gene of interest or insert is added into the plasmid vector. This is done…

Q: Explanation of why mutations vary in likelihood of causing disease depending on location relative to…

A: Phenylketonuria is caused due to a genetic mutation in the PAH gene( phenylalanine hydroxylase…

Q: What is the first step in protein synthesis? A. making an RNA copy of the DNA within the nucleus

A: In eukaryotes, they are made of DNA and a membrane-bound nucleus. The eukaryotes make their own…

Q: Which of the following functions can be fulfilled by Cas proteins? Create mutations in target DNA…

A: What is CRISPR - Cas system? CRISPR - Cas system is the innate immune system of bacteria &…

Q: Q: Define electrophoresis. What are the different types of electrophoresis used in separation of…

A: Electrophoresis is a laboratory technique that is performed to separate biological molecules like…

Q: Explain how the mRNA vaccine work and relate to protein synthesis  (Moderna and Pfizer vaccines are…

A: mRNA (messenger RNA) is a single-stranded molecule found in all of our cells. It transports the…

Q: 5. A DNA sequence of "ACG" will code for the amino acid First mRNA base (5' end of codon) U G UUU…

A: A codon is a sequence of three nucleotides in a messenger RNA (mRNA) molecule that specifies the…

Q: Under what conditions, a higher rate in the presence of the inhibitor observed? (how could the…

A: There is a gradual increase in reaction rate because competitive inhibitors are occupying only some…

Q: TRUE OR FALSE 1. A mutation is considered induced when a bacterial cell is exposed to harsh…

A: All the given statements are true.

Q: 21. What are the similarities and differences between the lactase persistence mutations found in…

A: Mutation can be defined as the change which occurs in the DNA which resulted in either addition or…

Q: Your lab is investigating cellulose degradation by Cellvibrio japonicus and has generated a large…

A: Genes encode for proteins that help in the growth of any organism. To check the importance or…

Q: 4. Draw the actual map of the PMBBS plasmid, following the style of the sample map shown in Figure…

A: Restriction enzymes:  Restriction enzymes are also called molecular scissors.  These are named so…

Q: What two 2° structures are highlighted (with the black circle) in this figure? The red amino acid…

A: The figure in the question depicts secondary structure conformation of a protein. Secondary…

Q: What is the most likely reason a southern blot may not be able to detect KSS in the clinic? O A…

A: Kearns-Sayre syndrome (KSS) is a mitochondrial myopathy with a typical onset before 20 years of age…

Q: Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger…

A: Sickle cell anemia is a genetic disorder affecting the structure and function of hemoglobin, a…

Q: Question 16 The full set of different transcripts expressed by a cell is called Proteome Genome…

A: Genes give data to building proteins. They don't anyway straightforwardly make proteins. The…

Q: acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Match each of the following with the best…

A: DNA is a self replicating molecule. DNA replication is a process by which both the strands of DNA…

Q: Why the MRNA is usually enclosed in a lipid vesicle,in an mRNA vaccine?

A: mRNA vaccines are composed of an invitro synthesized  mRNA that codes for the antigen of interest…

Q: 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence…

A: A) Lower Strand will act as template strand. B)5' ACUUCGAUAUGUCUAAAAUA 3'

Q: 1. Explain how DNA encodes genetic information. 2. Explain the role of complementary base pairing in…

A: Explain how DNA  encodes genetic information The arrangement, or sequence, of the nucleotides along…

Q: Cell lysis and protein purification of GST-DHFR-His using T7 RNA polymerase protein to express DHFR…

A: A flowchart is a diagram that shows the steps of the process through a workflow which makes it…