After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter fragments are produced. These fragments underwent Edman degradation to give the following short sequences: Trypsin Met-Ala-Arg Phe-Ala-Glu-Gln-Asp Gly-Glu-Tyr-Met-Cys-Lys Chymotrypsin Met-Ala-Arg-Gly-Glu-Tyr Met-Cys-Lys-Phe Ala-Glu-Gln-Asp What was the sequence of the original full-length polypeptide?

After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter fragments are produced. These fragments underwent Edman degradation to give the following short sequences: Trypsin Met-Ala-Arg Phe-Ala-Glu-Gln-Asp Gly-Glu-Tyr-Met-Cys-Lys Chymotrypsin Met-Ala-Arg-Gly-Glu-Tyr Met-Cys-Lys-Phe Ala-Glu-Gln-Asp What was the sequence of the original full-length polypeptide?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Identify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBR
A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).
A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?
Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
Consider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)
If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu synthetase, how will the following peptide sequence change upon mRNA translation? wild-type: Met-Lys-Leu-Pro-Ala-Leu-Val-Val-Ala O Met-Lys-Leu-Pro-Ala-Leu-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Leu-Leu-Ala O Met-Lys-Val-Pro-Ala-Val-Val-Val-Ala
A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Met
A sample of a peptide of unknown sequence was treated with trypsin; another sample of the same peptide was treated with chymotrypsin. The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were as follows: Trp-Arg-Thr-Gin Ser-Trp-Arg-His-Trp-Ala-Lys Asp-Val-Ala-Ala-Lys Asn-Ser-Asn-Val-Ile-Arg The sequences of the smaller peptides produced by chymotrypsin digestion were as follows: Arg-His-Trp Arg-Thr-Gin Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp The original peptide sequence was: Asp-Val-Ala-Ala-Lys-Ser-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-His-Trp-Arg-Thr-Gin Asp-Val-Ala-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin-Ser-Trp-Arg-His-Trp-Ala-Lys Trp-Arg-Thr-Gin-Asn-Ser-Asn-Val-Ile-Arg-Ser-Trp-Arg-His-Trp-Ala-Lys-Asp-Val-Ala-Ala-Lys Arg-His-Trp-Arg-Thr-Gln-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Asp-Val-Ala-Ala-Lys-Ser-Trp Asp-Val-Ala-Ala-Lys-Ser-Trp-Arg-His-Trp-Ala-Lys-Asn-Ser-Asn-Val-Ile-Arg-Trp-Arg-Thr-Gin…
Consider the following polypeptide sequence: Gly Val Tyr Ile Val Asp His Phe Thr Gly Asn Tyr Ala Leu Met Glu Asp Lys Aps Val Val Ala Tyr Glu His Ala Pro Lys Leu Asp Asp Phe Val Glu Glu Ala Ley Lys Val Glu Ala Gly Glu Val Pro Ala Ala Pro A) List the expected fragments that will result from proteolytic degradation with trypsin. B) List the expected fragments that will result from the reaction with CNBr. C) List the first three amino acids that will be identified by Edman degradation in the fragments generated in B).
Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop