Answered: Discuss the difference between intron…

Discuss the difference between intron and Exon

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 23RQ: Which of the following is not made out of RNA? the carriers that shuffle amino acids to a growing...

See similar textbooks

Similar questions

2. What is the relationship between a codon and an anticodon?
4. Refer to the genetic code table to find the amino acid that is encoded by the mRNA codon CCA. What bases would be found in the comple- mentary tRNA anticodon?
2. "Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by letter.
4. RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why single-stranded DNA cannot take part in eukaryotic intron splicing, while RNA can.
1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA sequence responsible for the mRNA codon? c. What is the amino acid coded?
2. Do you think mutation has any direct relationship with codon? Why/Why not? Please explain in your own words. [Max 200 words]
1. Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify its correct DNA sequence (*some codons are redundant or wobbled) using the CDNA libary?
32.
4. Mark the following statements about the genetic code as TRUE or FALSE: The genetic code is completely universal. One amino acid can be specified by more than one codon. Each codon can specify multiple amino acids. Each codon is 3 nucleotides long, yielding 64 different codons. There are three different "stop" codons each coding for a termination amino acid. For each false statement in # 4, explain why it is false.
1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC S' a. What amino acids are coded by this sequence? b. An adenine is inserted in this strand after the first guanine from the left. The resulting polypeptide is six amino acids long. Where is the newly produced nonsense codon located? What is the amino acid sequence in the fragment?
3. List the sequences for the "stop" codons.
3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…