A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Please answer fast
A. Below is a small 2 exon long gene. The exons are underlined, and the 22
5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT
ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC
TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’
1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction?
3'-____ -5'
2) What are the first five ribonucleotides of the mRNA transcript of this gene ?
5'-____-3'
3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript?
5'-_____-3'
4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides?
5'-_____-3'
5A) What are the first five ribonucleotides of the 3' UTR?
5'-_____-3'
B) What are the last five ribonucleotides of the 3' UTR?
5'-______-3'
6) How many amino acids are in the protein encoded by the mRNA?
____
7) Using a codon chart (posted under the Translation module in Moodle), translate the mRNA transcript into protein, using the single letter amino acid code and no spaces.
N terminus-_____-C terminus
8) The bolded "A" nucleotide near the beginning of line 2 is the adenine in the intron that is responsible for forming the lariat during splicing. It is thus part of the consensus splicing motif.
A) If this is mutated to G, what are the 5 ribonucleotides following exon 1 in the mature mRNA transcript?
5'-_____ -3'
B) Does this mutation result in a frame shift?
Answer YES or NO
C) How many amino acids are in the protein encoded by the mRNA following this mutation?
_____
D) Using a codon chart (posted under the Translation module in Moodle), translate the mRNA transcript with the mutation described in 8A into protein, using the single letter amino acid code and no spaces.
N terminus-_____-C terminus
9) In another mutation from the original wild-type sequence, the bolded G in the middle of the second line is mutated to A.
A)How many amino acids are in the protein encoded by the mRNA?
______
B) Using a codon chart (google it), translate the mRNA transcript with the mutation described in 9 into protein, using the single letter amino acid code and no spaces.
N terminus-_____-C terminus
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
