Below is an image of translation occurring in the direction indicated by the arrow. Use the image below and its labels to match to the following statements. Some choices may not be used and choices may be used more than once.

Below is an image of translation occurring in the direction indicated by the arrow. Use the image below and its labels to match to the following statements. Some choices may not be used and choices may be used more than once.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: Phylogenetic hypothesis 1 requires. changes, whereas hypothesis 2 requires Hypothesis I Hypothesis…

A: Phylogeny represents evolutionary relationship between taxons. It is used to find the evolutionary…

Q: QUESTION 3 Given tubes of equal length and diameter (and the inflow/outfow pressures below), which…

A: Blood flow The local blood flow is the amount of blood that passes through any tissue in a specific…

Q: What two important characteristics allow us to identify a cell in interphase?

A: An active living cell undergoes two major phases - the mitotic phase where the cell divides into two…

Q: Acetylcholine is a neurotransmitter that, when bound to its receptor, causes the receptor to open a…

Q: what ways to modify food and kcal intakes to achieve beneficial physiological changes

A: Beneficial physiological changes : Physiological changes in day-to-day life and activities that can…

Q: is energy is released when ATP loses a phosphate group true about ATP and ADP

A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…

Q: Describe the process of protein synthesis and trafficking of a protein, a lysosomal hydrolase,…

A: Introduction All cell membranes that exchange lipids and proteins are included in the endomembrane…

Q: On 17 August 2022, the Ministry of Health of the Democratic Republic of Congo (DRC) reported a…

A: It is well recognized that the Ebola virus (EBOV), a public health emergency of worldwide concern,…

Q: Calculate respiration and gross primary productivity for Lake Hugo? Results should be in mg O2…

A: Introduction :- The life-sustaining process of respiration involves the exchange of gases between…

Q: Kary Mullis invented the Polymerase Chain Reaction (PCR) technique in 1983 which won him the 1993…

A: Polymerase Chain Reaction: A very small DNA sample can be amplified (or part of it amplified) to a…

Q: 32. What are the two components of tRNA which are important for building a protein? what are…

A: The tRNA is responsible for transferring amino acids to the ribosome at the site of translation.…

Q: Which of the following would be most likely to have a dramatic effect on the amino acid sequence of…

A: The protein is a sequence of amino acids. The two amino acids are joined by peptide bond.

Q: Discuss mechanisms by which cells communicate in short and long distances.

A: "Cells" communicate via their own chemical signaling system. Different chemicals, such as hormones…

Q: Number of Taxa 3 4568 4 10 Number of possible trees (Write your answer from 5a) 15 105 945 135,135…

A: Branches: If there are n-taxa in an unrooted tree, there are 2n-3 branches

Q: Why do some types of signal molecules (first messengers) need to use second messengers to cause a…

A: Introduction :- The cell releases intracellular signalling molecules known as second messengers in…

Q: Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T.…

A: Cloning methods are used in biotechnology for various purposes. TA cloning is the technique that…

Q: Besides cloning vectors, there are also expression vectors. What is the main differenc between these…

A: cloning vector is a small piece of DNA that can be inserted into organism for cloning purpose.…

Q: QUESTION 45 Which of the following statements is FALSE? Low oxygen levels in the blood increase…

A: Introduction: The body's cells require energy for metabolism, that is supplied by the blood from the…

Q: Differentiate between the following terms used in medical epidemiology: 4.1. Sporadic vs endemic…

A: Sporadic refers to a disease that occurs infrequently and irregularly, it does not show any common…

Q: cterium-mediated plant transformation is a method used to create transgenic plants cterium…

A: Agrobacterium tumeifaciens is a bacteria that invades some plants at the site of wound. They…

Q: If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3'…

A: Introduction :- All living things require primers, which are brief, single-stranded nucleic acids,…

Q: which of the following influences the bonding of oxygen to to hemoglobin? a) pH b) oxygen…

A: Hemoglobin molecule is the combination of a globin protein molecule and non-protein part heme and is…

Q: Which phyla did you not expect to be grouped together based on their morphology? How could…

A: Introduction Systematics is a branch of biology that deals with classifying and cataloging animals…

Q: Many invasion process models (including the framework in Blackburn et al. 2011) have emphasized that…

A: Invasion : Biological invasion is a process by which an organism introduced to and establishes a…

Q: What process might give rise to this population of cells?

A: White blood cells (WBC) are a variety of nucleated cells that circulate for at least a portion of…

Q: 26) Eukaryotes are unable to couple transcription and translation because: A) the two processes…

A: Introduction: RNA serves as a template for the production of proteins. Aligning the set of…

Q: 3. Why does intercellular spaces are absent in sclerenchyma tissues?

A: Tissue is a group of cells. These cells work together to perform specific function.

Q: Describe in detail the connection between neurotransmitters and Parkinson disease. (150 words)

A: Parkinson's disease (PD) is a neurodegenerative ailment that progresses and is characterised by…

Q: Why can more organisms tolerate higher concentrations of sugar than salt? Please explain from both…

A: Introduction:- Organisms habitat that contain an excess of carbohydrates in the form of sugar are…

Q: What is the probability that Mike is carrier? 1/6 1/4 1/3

A: Answer The probability will be 1/4 Reason : As both of the parents phenotypically but their family…

Q: Which of the following is FALSE about fruit? A. Mature ovary B. Protect seeds and aid in dispersal…

A: Introduction : Angiosperms are flowering plants that produce fruits with seeds inside of them. They…

Q: How many NADH, FADH2, NADPH and ATP will be generated when breaking this fatty acid down into…

A: Fatty acids are broken down into acetyl-CoA by beta-oxidation within the mitochondrial matrix and…

Q: Below is the skeletal formula of a molecule typically found in cell membranes. What type of molecule…

A: The plasma membrane of the cell determine the movement of molecules in and out of the cells. The…

Q: Which enzyme is used for catalyzing the phosphorylation of glucose as well as the phosphorylation of…

A: Cellular respiration is a phenomenon in which glucose is used and of liberation of ATP takes place .…

Q: 5. Which is the best description of a stem cell. A) A cell that has differentiated into a…

A: Answer: The best description of a stem cell includes two options : A) A cell that has differentiated…

Q: 2. Why did the reindeer grow at this rate?

A: An organism's "niche" is defined by the collection of circumstances, supplies, and relationships…

Q: Write the basic information of different types of rats or mice( at least 7 and add their pictures).…

A: 1- House mouse (Mus musculus) Color: black or dusty gray. Weight : 0.75oz Length : 6 to 7 inches.…

Q: It is often stated that excess mortality (in general) is higher in low socioeconomic populations.…

A: Mortality rate It is a measurement of the number of deaths (or deaths related to a particular cause)…

Q: From the DNA sequence data for the eight species (A through H) shown below, what is the genetic…

A: The DNA is the genetic material in living organisms that shows specific sequence of nucleotides. The…

Q: Answer these questions in a You may include labeled drawings or tables, if helpful. Short answers,…

A: Countless trillions of chemical reactions take place daily in our bodies to support vital metabolic…

Q: Why Researchers choose to use animal models in pharmaceutical research? Explain. Please explain at…

A: In the UK, about one-third of animal research is carried out by or funded by the pharmaceutical…

Q: true about slow motor units?

A: The true about slow motor units is they have a high number of mitochondria.

Q: a) Based on this tree is the chicken, mouse, human, or hamster most closely related to the bat? b)…

Q: Control of blood flow is primarily mediated by

A: Arterioles, small blood vessels that carry blood away from your heart. They control blood flow…

Q: homology modelling and such are available free online. State the functions of CLUSTAL W, BLAST and…

A: Numerous computational methods are used in bioinformatics, that include sequence and structural…

Q: 2) List the names of the two major Contractile Proteins. Which of the proteins is "bound" and…

A: 2 Given that it is composed of two phospholipid layers, the plasma membrane is known as a…

Q: Describe four different uses for thoracic appendages seen in different crustaceans. Use specific…

A: Crustaceans form a large, diverse arthropod taxon which includes animals such as decapods, seed…

Q: Differentiate among between Northern, Southern and Western blotting techniques.

A: Answer Difference between Northern , Southern and Western blotting is under : 1) Northern blotting…

Q: 10 b. The half-life of polonium-218 is 3.0 min. If you start with 20.0 g, how long will it be before…

A: According to the question The initial concentration is 20g No = 20g The final concentration…

Q: Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at…

A: The polymerase chain reaction (PCR) was hugely successful in molecular biology. PCR tests are…

Question

some of the answers below are wrong. i need help identifying which ones go on which.

thank you!

Below is an image of translation occurring in the direction indicated by
the arrow. Use the image below and its labels to match to the following
statements. Some choices may not be used and choices may be used
more than once.
4
mRNA
1
2
Where the empty t-RNA
leaves
where the charged tRNA
carrying the next amino
acid comes in
5' end of mRNA
3
where the polypeptide
chain is made and extended
4
3
2
4
Ê

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdf
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hp
If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'
thank you
Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post transcriptional processing Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference 5’ CTATATTTATGTGCTATATCCAGGACTGCCCCTAGGAAATAAAAAA…AAAAAAA 3’3’ GATATAAATACACGATATAGGTCCTGACGGGGATCCTTTATTTTTT…TTTTTTT 5’