1 a- What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs? b- Nucleic acid structure Describe briefly what is meant by saying that two DNA strands are complementary. c- Identify DNA structural and functional elements from the nucleotide sequence information. Listed below are five DNA sequences. Which one contains a type-II restriction endonuclease (6 cutter) hexanucleotide site? Which one is likely to form a cruciform structure (draw the structure)? Which one is likely to be found in the Z-DNA form? Which one represents the 5' end of a tRNA gene? Which one is most likely to be in the triplex form? a. CGCGCGCCGCGCACGCGCTCGCGCGCC GC b. GAACGTCGTATTTCCCGTTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCG

Q: Question 17 A male patient is receiving heparin by continuous intravenous infusion. The nurse will…

A: Medicine now is radically different from what it has previously been in our history and culture. We…

Q: The phospholipids of a cell membrane are arranged into a ________________.

A: The basic, structural and functional unit of life is the cell. A cell is the smallest unit of life…

Q: Salma Rick Layla Adie Mac A Rh A Rh Rh Rh Rh B B B The blood type for Salma is The blood type for…

A: The blood type for Salma is A positive The blood type for Rick is AB negative  The blood type for…

Q: True or false: each human child, other than identical twins, is genetically unique

A: Monozygotic twins are also called as identical twins, from 1 fertilized egg. They happen when one…

Q: Diglycerides are made of glycerol and __________

A: Diglycerides are a form of glycerides that are involved in biochemical signaling. These molecules…

Q: Briefly explain how enzymes speed up a chemical reaction.

A:

Q: gene's _____________ is its physical place on a chromosome.

A: Gene is a unit of hereditary transfered from one generation to another.

Q: True or false? Dr Walden ordered a CBC, CMP, and lipid panel on mr. Bowden the medical assistant is…

A: Question is related to true and false.  In this question asked about the job responsibilities of…

Q: If someone goes on an unhealthy no carb diet their body will still need carbs (glucose) to fuel…

A: Carbohydrate also known as saccharides, is one of the three macronutrients of the food. It's…

Q: Beta glucan is a form of soluble fiber that can reduce blood cholesterol. is a protein that contains…

A: Beta glucan is a type of soluble fiber that is found in various sources such as oats, barley,…

Q: the cause of UTI (easy and simple)

A: The infection of any part of the urinary system including the kidneys, ureters, bladder, or urethra…

Q: In making an artificial cell, the plasma membrane is represented by ____________ _____________.

A: Artificial cell is that synthetic arrangement of particles which together mimics an actual…

Q: QUESTION 4 Hyperinsulinism would result in. OA. Hyperglycemia OB. Hypoglycemia OC. A condition where…

A: The question is asking about the potential outcomes of hyperinsulinism, a condition characterized by…

Q: Mitosis is the process of nuclear division. The process of dividing the cytoplasm is called:…

A: Cell division is the process by which the parent cell is divided into two as a daughter cell. It is…

Q: Mnemonic about the UREA CYCLE that is not from the internet. Thank you.

A: Urea cycle is also known as the Ornithine cycle. In urea cycle urea is produced from ammonia. Urea…

Q: After death, two decomposition processes take place:___________ and ___________.

A: The human body is a living organism and thus it follows the cycle of life which starts with the…

Q: True or False (Circle your answer): Glucose is of low energy when it enters the cell and thus ATP is…

A: Glucose is got from the food we eat. It comes from carbohydrate rich food.  Our body needs a…

Q: rederick the Great believed that this drug would make his soldiers unfit to fight a war: coffee O…

A: Frederick II of Prussia, aka Frederick the Great, is the most famous an one the most notorious…