Q: Please help me with this. *Also Please Note: This is ONE problem set and according to the policy,…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: The SDI is essentially focused on what three things?
A: SDI: Simpsons diversity index usually used to measure the biodiversity.
Q: I need help with number 35, 39, 40, 41, 42, 43, and 44. Is this all the correct answer?
A: The above figure shows the interior view of a skull
Q: O D. Yes, I agree.
A: 1. Yes , I agree .
Q: I need option asap
A: We know that Female body undergoes various hormonal changes during pregnancy. Hormonal fluctuations…
Q: Select the one (1) correct answer. The Health and Safety at Work Act does not protect: Employees.…
A: The Health and Safety at Work Act outlines the essential framework and authorities for encouraging,…
Q: kindly answer this, thankyou! How will the world look like without nurses?
A: Nursing: This is a noble profession in the healthcare setting.This can be considered as an art and a…
Q: Why is too much Na intake prohibited for people with known heart disease? Please explain in a way…
A: Salt, commonly known as sodium chloride, is made up of around 40% sodium and 60% chloride. It is…
Q: need the answer as soon as possible
A: Definition: Congenital heart defect is a category of heart disease that includes abnormalities in…
Q: s soon as possible please?
A: Atherosclerosis:-This is also called arteriosclerotic vascular disease(ASVD)-It is defined as that…
Q: PLEASE MATCH THEM BETWEEN 66-75.
A: Ecology sounds as “a study of animals and plants in their relation to each other and to their…
Q: Badly needed your help...can someone answer this please,do not ignore please...true answers…
A: To get the remaining sub-parts solved, please repost the complete question and mention the…
Q: Hello good day, I hope today has been kind to you. So I am having a problem answering this question…
A: Histology is made up of a Greek word histos that means tissues or columns, logia means study. It can…
Q: 5. If there is too much HDL in the blood, it can become lodged in arterial wall and contribute to…
A: Question 35. ANSWER If there is too much HDL in the blood , it can become lodged in arterial wall…
Q: pesticides
A: Definition of Pesticide: Pesticides are the substances which are meant to control the pests.…
Q: I want change the nursing diagnosis number 3 with another nursing diagnosis. Thanks
A: The clinical judgment about individual responses to actual or potential health problems is known as…
Q: e I will give downvote.
A: Answer 1:- The answer to this question is (C) Fitness varies amongst the offsprings. Answer 2:-…
Q: Cancer is classified with the type 1 of DM True False
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: Would you like to eat? Yes, l'd love. This (10 sentence grammatically is True .a False .b
A: Yes this sentence is right grammatically. There is no error in this sentence but it can be more…
Q: I need help with the 2 questions attached below
A: Answer 1: Open ocean
Q: The ability to curl the tongue is a
A: Answer: Inheritance : It is the process of gaining some characteristics or properties from parents…
Q: Deficiency of zinc manifestations
A: Zinc is a mineral that is required for many enzymes in the body. It acts as a cofactor for enzymes…
Q: Each reading frame will predict the same length polypeptide. O True False
A: 1) DNA is a double-stranded molecule that carries the genetic information of a living cell. DNA is…
Q: I really dont understand this one I hope you can help me with this. Thank you so much. It has a 10…
A: The excess glucose molecules present in the blood are stored in the form of glycogen in the liver…
Q: 140- 120- 100- 80- 60- 40- 20- 0+ 10-10 10-9 10-8 107 106 Concentration of anesthetic (Molar) Answer…
A: 10-6 concentration of anesthetic has the least variation in its effect on muscle contraction. Hence…
Q: O Both statements are correct
A: ADRENERGIC SYSTEM_ Activation of the adrenergic system has a profound effects on metabolism.…
Q: Please i really need the right answer there is mutiple queshtions and i need the right answer and…
A: B is the correct answer. Multiple alleles occur when there are more than two possible alleles for a…
Q: I need help finding the right answers to the queshtions
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 3 1 7 2.
A: Bone is a mineralized connective tissue that displays four types of cells including osteoblasts,…
Q: What hormonal changes do take place in humans when they try to reproduce? This assignment needs to…
A: Hormones are chemical substance which behaves like messenger molecules and produced in our body.…
Q: explanation
A: 1> answer is D 2> FADH2 is a reduced molecule FAD reduced to FADH2. 3>option c. 4…
Q: Can u help me answer number 5-7 ?thank youu
A:
Q: 1) What is the fulcrum? 2) What is the effort?
A: Fulcrum or Support, a word that signifies "bedpost" in Latin, gets from the action word fulcire, and…
Q: I need help with questions 3-7
A: Evolution is defined as the biological process and is thus, a change in the characteristics…
Q: hormone level in blood
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Q: hello, I am in my 20s, male and I wanted to ask you guys what are the high-risk conditions that I…
A: A male at the age of 20 can face following high -risk conditions:- 1) DRINKING ALCOHOL AND…
Q: 31
A: A phosphate group, a 5-carbon sugar ring (ribose/deoxyribose), and a nitrogenous base make up the…
Q: need help with these questions.
A: Steroid and thyroid hormone receptors are found in the cytoplasm or nucleus of target cells and…
Q: A. В. A O b Oc US V 3:39 B.
A: Water molecule is composed of two hydrogen atoms and one oxygen atom. Our body is composed of almost…
Q: Please help me with this question at the earliest ???within an hour
A: BASIC INFORMATION ECOLOGY When the relationship between the organisms living on the earth and…
Q: Question: Discuss the significance of doing water bacteriology on drinking water from the community.
A: Q. Discuss the significance of doing water bacteriology on drinking water from the community.…
Q: How essential are recreational activities in our holistic health and wellness? Please answer it in…
A: Recreational activities is a broad concept of diverting our energy for pleasure feeling through…
Q: Says passi Voice is generan ung as section. True False
A: while writing methodology few things to be followed. 1. write aim of the experiment 2. principle of…
Q: Diabetic mellitus may cause acute and chronic vision loss I need answer within 3 minutes with my…
A: Diabetes mellitus causes a wide range of complications from retinopathy to neuropathy, nephropathy .
Q: Simply True or False. Please
A:
Q: 1. How much active ingredient in 20 cc of a 15% solution? 2. You have 1:1000 concentration of…
A: Administering the correct concentration of the drug to the patient is necessary to obtain desired…
Q: Hi there! Would you be able to assist with this question?
A: Mitosis is a type of cell division in which one cell divides to produce two daughter cells that are…
Q: Which concentration of anesthetic has the least variation in it's effect on muscle contraction? A)…
A: 1. 10^-10 2. Option D As the concentration of anesthetic is increased, the mean number of muscle…
Q: Partyl Answer After the Video ons: Write the correct name of each on the line above each picture.…
A: Meiosis: It is a type of cell division in which one mother cell divides into four genetically…
Hi I hope you're doing fine.
I need help with these questions please!
thank you!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…In prokaryotes, a search for genes in a DNA sequenceinvolves scanning the DNA sequence for long openreading frames (that is, reading frames uninterruptedby stop codons). What problem can you see with thisapproach in eukaryotes?Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
- Some exons in the human genome are quite small (lessthan 75 bp long). Identification of such “microexons” isdifficult because these distances are too short to reliablyuse ORF identification or codon bias to determine ifsmall genomic sequences are truly part of an mRNAand a polypeptide. What techniques of “gene finding”can be used to try to assess if a given region of 75 bpconstitutes an exon?A common strategy for identifying distantly relatedhomologous proteins is to search the database using a shortsignature sequence indicative of the particular proteinfunction. Why is it better to search with a short sequencethan with a long sequence? Do you not have more chancesfor a “hit” in the database with a long sequence?Part A In this exercise, you will compare the amino acid sequence from the aphid to the amino acid sequences of the other species to identify how similar they are. As a first step, you will compare the aphid sequence (Acyrthosiphon) to a bacterial sequence (Pantoea). The sequences below show the first 60 amino acids of one polypeptide, using the one-letter abbreviations for the amino acids. An underscore () indicates a gap inserted in a sequence to optimize its alignment with the corresponding sequence in Arabidopsis. Acyrthosiphon (aphid) IKIIIIGSGV GGTAAAARLS KKGFQVEVYE KNSYNGGRCS IIR HNGHRF DQGPSL YL Pantoea KRTFVIGAGF GGLALAIRLO AAGIATTVLE QHDKPGGRAY VWQ DQGFTF DAGPTV IT (bacterium) At how many positions are the amino acids the same between the two species? There are positions with the same amino acid. Submit Request Answer Part B Complete previous part(s) P Pearson MacBook Pro G Search or type URL * #3 $ & 7 8 delete 3 4 { T Y U P E F H J K > C V N M command option command .. .- B…
- The Shine-Dalgarno Sequence is used in bacteria eukaryotes bothThe human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
- Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGThe estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDaThe goal of many computer programs is to identify sequence elementswithin a long segment of DNA. What is a sequence element? Givetwo examples. How is the specific sequence of a sequence elementdetermined? In other words, is it determined by the computer programor by genetic studies? Explain.