A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of nucleotide bases) was removed during mRNA processing, how many amino acids is expected to be in the protein that the matured mRNA codes for? [ Select ] Note: Include the start and stop codons in your analysis. B. If the first five codons of the MRNA is AUGAUGAUGAUGAUG, what is the amino acid sequence of the pentapeptide that the five codons will make? ( Select ]

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Discuss the two steps involved in RNA processing. Please explain each step in 2-3 sentences only.

A: In Eukaryote, mRNA produced during the transcription process is known as pre-mRNA. They undergo…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The transcription of DNA produces mRNA. The process by which this mRNA is read by ribosomes, and a…

Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…

A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: vell. A study on this organism found that two mature mRNA molecules are produced for this gene. One…

A: Few points to understand mRNA processing --- In prokaryotes transcription and translation occurs…

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: m

A: DNA → RNA RNA → protein

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: b. The process by which the DNA instructions are converted into the functional product is called…

A: DNA m-RNA A U G C G C T A T A A U C G T A G C

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is…

A: Gene expression refers to the process that involves the formation of a functional product of a…

Q: A.  Which two of the three modes of RNA processing are necessary to increase mRNA stability?   B.…

A: A.) Three major events constitute pre-mRNA processing: (a) 5'-end-capping, (b) splicing, and (c)…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: The queation on my assignment is select the description of an exon? the answers they give are: 1.…

A: An exon is a coding region of the gene that codes for amino acids. In eukaryotes, genes are made up…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts.

A: When an RNA transcript is first made in a eukaryotic cell, it is considered a pre-mRNA and must be…

Q: Identify the secondary structures present in the protein and its genes code…

A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…

Q: A segment of template DNA is known to contain the following base sequence: 3'…

A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Q: The following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene…

A: In molecular biology, mRNA is a single-stranded molecule of RNA that corresponds to the genetic…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.