1)post translational processing of polypeptide chains including phosphorylation,acetylation,methylation,glycosylation is often required before proper function (true or false) 2)defective mRNA containing premature stop codons are destroyed by nonstop decay (true or false) 3) many polypeptides possess special amino acid sequence that targets them to their appropriate location (true or false)

1)post translational processing of polypeptide chains including phosphorylation,acetylation,methylation,glycosylation is often required before proper function (true or false) 2)defective mRNA containing premature stop codons are destroyed by nonstop decay (true or false) 3) many polypeptides possess special amino acid sequence that targets them to their appropriate location (true or false)

Name: 1)post translational processing of polypeptide chains including phosp
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1)post translational processing of polypeptide chains including phosphorylation,acetylation,methylation,glycosylation is often required before proper function (true or false)2)defective mRNA containing premature stop codons are destroyed by nonstop

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Similar questions

Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are inserted
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
ADP ribosylation is one example of post-translational modification of an enzyme. Which statements about the process is true? ADP ribosylation will affect protein folding because of the addition of a large molecule ADP ribose can be added to the amine group of lysine or glutamine The ending of DNA around histones in the nucleus is altered by the ADP -ribosylation of the histone proteins in cancer cells ADP ribosylation requires ADP and the target protein as the substrates in the ADP ribosylation ADP ribosylation of phosphoinositol is an important step in signaling through a G protein-coupled receptor pathway.
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
For each of the five short mRNA nucleotide sequences given in the table below: 3. Translate the original sequence (for these short sequences start translation at the first nucleotide) 4. Identify (and highlight or underline) the one nucleotide difference between the original (left) and altered (right) sequences 5. For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above) 6. Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If so, what is the effect of the mutation on protein structure (amino acid sequence; see #2 above)
Post-translational modification of proteins refers to the covalent and enzymatic modification of proteins following protein biosynthesis. Give three (3) examples and briefly describe why the modification is important.
Part of being a detective is being able to decode secret messages left behind by certain perpetrators or victims. The following DNA sequence encodes for at least 4 amino acids at the extreme C-terminus of a protein. What is the sequence of the polypeptide encoded by this gene fragment? Please provide your answer using the 1-letter abbreviations for amino acids. Additionally, please show your work, and be sure to designate the N-terminus and C-terminus of your polypeptide. 5'-TATGCTAGGCATTGTCGTAGGCATACG-3' 3'-ATACGATCCGTAACAGCATCCGTATGC-5'
The template strand (i.e.: the strand that is transcribed into RNA, which is usually represented “at the bottom”) of a segment of double helical DNA contains the sequence (5′) TCCGCTCCATCG (3′). What is the base sequence of the mRNA that can be transcribed from this strand?
At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, FRNA, and tRNA by moving the descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA. MRNA FRNA tRNA MRNA, FRNA, and tRNA Answer Bank contains nucleotide triplets that code for specific amino acids acts as an enzyme for peptide synthesis has a convoluted structure with a three-base sequence called an anticodon moves amino acids to the site of protein synthesis in eukaryotes, can exist outside the nucleus moves genetic information out of the nucleus and into the cytoplasm composed of ribonucleic acid
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…