12. You are working with a picce of DNA of the sequence:5'-TATTGAGCTCCCCGGAT-33'-ATAACTCGAGGGGCCTA-5You cut the above piece of DNA with a restriction enzyme that recognizes thesequence 5'GAGCTC and cuts on the 3' side of the A within this sequence.Please, draw all products that you get after digestion. Label all 5' and 3' ends.

Restriction enzymes cut DNA at a specific location called as restriction site.

Answered: 12. You are working with a picce of DNA…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

GD Label the sugar and phosphate. Label the bases that are not already labeled
19. You run a PCR of the above HBB sequence using the primers you designed. You receive a vector from a company that you want to clone your HBB PCR product into. Below is the vector: BamHI 0.5 kb EcoRI 1.0 kb 0.3 kb -Bglll plasmid A 0.2 kb BamHI 0.4 kb HindIII 1.0 kb EcoRI You want to cut this vector with BamHI and EcoRI and insert your PCR product into this vector. After cutting the vector with both enzymes simultaneously you run a gel. i) On the gel below draw the bands you expect to see after you cut this vector with these enzymes at the same time (only use one gel lane - the other one is going to be empty). (6 points) Ladder 5kb 3kb 2.5kb 2kb 1.5kb 1kb 0.5kb 0.3kb 0.2kb ii) Circle the band that represents the backbone that you will insert the PCR product into. (2 points) c) Once you have inserted the PCR product into the plasmid backbone from part C, how many bp will the new vector be (the total of the backbone and the PCR product together). Answer should be 2 significant figures.…
8. You perform a PCR experiment using the template and primers shown below. What size is the amplicon (aka the PCR product) in bp? Template Q8: 5' TCGGC CGTAC TACGA TCGAT TGCGT ACGCA ATCGC -3' ¦¦¦¦¦ ¦¦¦¦¦ ¦¦¦¦¦ ¦|||| |||||||||| 3' AGCCG GCATG ATGCT AGCTA ACGCA TGCGT TAGCG -5' Primers: 5'-CGTAC-3' & 5'-TTGCG-3'
2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TAССT GCA 11) TGCAA GCCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut DNA, how many DNA fragments will result? Circle the fragments. Uncut DNA 1: TGATCGTGGAATTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTTAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Number of fragments: Uncut DNA 2: Number of fragments: Length of fragments: TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGAATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACTTAAGTTTTTT Uncut DNA 3: basepairs (ignore ends with unpaired bases) Length of fragments: basepairs (ignore ends with unpaired bases) TGATCGTGGACTTCGATGATCGAATTCGCTAGCTGCATTCAAAAAA ACTAGCACCTGAAGCTACTAGCTTAAGCGATCGACGTAAGTTTTTT Number of fragments: Length of fragments: basepairs (ignore ends with unpaired bases) 4. You are given a new sample of DNA that matches one of the uncut samples above (1, 2, or 3). How could you use restriction enzyme analysis to match your unknown sample to one of the known samples (1, 2, or 3)? Explain below.
25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
5. Design a 10-bp primer that could be used to amplify the following sequence of DNA: 5'-AGTCGATCCCTGATCGTACGCTACGGTAACGT-3'
1. A plasmid was digested with two restriction enzymes, individually and in a double digest. The following fragment sizes (bp) were determined by agarose gel electrophoresis. Restriction Enzyme|Fragment Size (bp) 30, 15, 5 HindIII 50 EcoRI + HindIII 20, 15, 10, 5 Make a restriction map of the plasmid based on this data and indicate the distances between the restriction sites.
4. A linear piece of DNA has the following EcoRI restriction sites. EcoRI site 1 2 kb 4 kb EcoRI site 2 5 kb a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel.
8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.
4. A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gel electrophoresis, to yield the gel profile shown below. The first lane contains the size marker (M). M Undigested EcoRI control PvuII ECORI + PvuI 12000 bp 9000 bp 6000 bp 5000 bp 4000 bp 2000 bp 1000 bp Explain how the name of the enzyme ECORI is derived. How many sites are there for EcoRI and PvuII respectively on this DNA fragment? b) c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNA fragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on the map.
1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene product. 3' TAC GAA ATA ACA GTA CGA CCA AAA CTT TAC ACT S 2. Assume the following nucleotide changes in the DNA strand above and write down the amino acid sequences. a. Insert thymine after position 10 of the base. b. Delete base number 9. c. Replace position 18 with guanine. d. Replace the 10th to 12h nucleotides with TAG. e. Replace the 3d to 5th nucleotides with ATT. Guide Questions

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS