12. You are working with a picce of DNA of the sequence:5'-TATTGAGCTCCCCGGAT-33'-ATAACTCGAGGGGCCTA-5You cut the above piece of DNA with a restriction enzyme that recognizes thesequence 5'GAGCTC and cuts on the 3' side of the A within this sequence.Please, draw all products that you get after digestion. Label all 5' and 3' ends.

Restriction enzymes cut DNA at a specific location called as restriction site.

Answered: 12. You are working with a picce of DNA…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

3. A linear DNA fragment is cleaved with one, two or three restriction enzymes to yield fragments as follows: Enzyme(s) Fragments (kb) HindIII 2.5, 5.0 Smal 2.0, 5.5 HindIII + Smal 2.5, 3.0, 2.0 HindIII+ Smal+ EcoRI 1.5, 2.0, 2.5 Draw the restriction map of the original DNA fragment, indicating the positions of all restriction sites.
Above are the results of gel electrophoresis following digestion with restriction enzymes. What is the total length of the DNA fragment? Which enzyme, HindIII or EcoRI, produced a larger fragment? What part of DNA causes it to be negatively charged in order for electrophoresis to work?
1. A DNA sequence 10 kb long contains one site at which it may be cut by the restriction enzyme Pstl. The same 10 kb long sequence also contains one site that can be cut by restriction enzyme Bg/II. Three separate fractions of this DNA were treated separately, as follows: 1) digestion by Pstl; 2) digestion by Bg/II; 3) digestion by both enzymes. The three treated fractions were then subjected to gel electrophoresis. The following table shows the lengths of the restriction fragments associated with each treated fraction. From the result, draw a restriction map that shows the Pst and the Bg/II cutting sites in the 10 kb DNA. Enzyme in mixture Pstl BgIII Pstl and BgIII Fragment Lengths (kb) 6.4 and 3.6 8.8 and 1.2 5.2, 3.6 and 1.2
A restriction endonuclease, REI, recognize AAGCTT and cleaves between A and A in the sequence. Given a DNA segment in Figure 2, draw to show the sticky end products after this DNA segment is reacted with REI. 5 Č ČÁ Á G G GT T CGAAC 3'L 5' Figure 2
GD Label the sugar and phosphate. Label the bases that are not already labeled
First please note this is DNA-B and NOT DNA-A, also the marked answer was wrong so please choose another one
19. You run a PCR of the above HBB sequence using the primers you designed. You receive a vector from a company that you want to clone your HBB PCR product into. Below is the vector: BamHI 0.5 kb EcoRI 1.0 kb 0.3 kb -Bglll plasmid A 0.2 kb BamHI 0.4 kb HindIII 1.0 kb EcoRI You want to cut this vector with BamHI and EcoRI and insert your PCR product into this vector. After cutting the vector with both enzymes simultaneously you run a gel. i) On the gel below draw the bands you expect to see after you cut this vector with these enzymes at the same time (only use one gel lane - the other one is going to be empty). (6 points) Ladder 5kb 3kb 2.5kb 2kb 1.5kb 1kb 0.5kb 0.3kb 0.2kb ii) Circle the band that represents the backbone that you will insert the PCR product into. (2 points) c) Once you have inserted the PCR product into the plasmid backbone from part C, how many bp will the new vector be (the total of the backbone and the PCR product together). Answer should be 2 significant figures.…
In the double-stranded DNA fragment below, the coding sequence for the mutant gene X' is read from left to right, while the coding sequence for the mutant gene Y' is read from right to left. Gene X' 5' ATGG GAGCACAAGGATAAGATGGATATCATTAG 3' 3' AATTA CCCTC GTGTTCCTATTCTACCTATAGTA 5' Gene Y Type the template strand of Gene Y' on the space below (do not type 5' and 3' labels; do not type a space between nucleotides).
25. Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand. DNA AAT GGT CCA CCG CTG 1TI 111 11 T Ou GGT GGC GIC MRNA Amino Acids UUA = leucine %3D GAC = asparginine GGU = glycine GGC = glycine CCA = proline %3D AMAM b iwi tant neto10 e 2obitoabun St
1. A plasmid was digested with two restriction enzymes, individually and in a double digest. The following fragment sizes (bp) were determined by agarose gel electrophoresis. Restriction Enzyme|Fragment Size (bp) 30, 15, 5 HindIII 50 EcoRI + HindIII 20, 15, 10, 5 Make a restriction map of the plasmid based on this data and indicate the distances between the restriction sites.
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' GGTACC3' 3 CCATGGS 3 CCATGGS Kpnl Aсс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
y Cours S DIOE The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). Kpn I Sall Eco RI Pst Bam HI Xho Bam HI Pst i Eco RI Kon I 100 200 300 400 500 B00 700 800 900 1000 1100 1200 1300 1400 1500 1600 1700 1800 1900 2000 How many total restriction fragments will result if you complete digest the DNA fragment above with Sal I? cross out a. 1 cross out b. 2 cross out O c. 3 cross out d. 4 cross out e. 5 cross out O f. 6 cross out g. 7 cross out Oh. 8 The following DNA fragment shows where a number of restriction endonucleases cut sites occur within the fragment. The numbers below indicate the distance between those cut sites in base pairs (bp). t of Sal Eco RI Pat Xhol Bam HI Psti Eco RI Koni Kpn i Bam H

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS