1. If there were only two alleles of TAS2R38 (AVI and PAV) in the human population, what are the possible allelic combinations in diploid cells? 2. For the sake of simplicity, assume that only the amino acids Pro, Ala and Val make up the functioning active site pocket within the taste receptor TAS2R38. Using your knowledge of amino acid properties, describe the environment of the active site. Is it surprising that changing these amino acids to Ala, Val and Iso, respectively, inhibits the receptor from binding PTC?

1. If there were only two alleles of TAS2R38 (AVI and PAV) in the human population, what are the possible allelic combinations in diploid cells? 2. For the sake of simplicity, assume that only the amino acids Pro, Ala and Val make up the functioning active site pocket within the taste receptor TAS2R38. Using your knowledge of amino acid properties, describe the environment of the active site. Is it surprising that changing these amino acids to Ala, Val and Iso, respectively, inhibits the receptor from binding PTC?

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Vibrio cholerae are associated with fresh water in cholera endemic areas, would you expect gene expression of V. cholerae cell's to be the same when in fresh water compared to the human gut? Explain.
2. a. If you were interested in the role of a particulargene in the embryonic development of the humanheart, why would you probably study this role in amodel organism, and which model organism(s)would you choose?b. If you were interested in finding genes that might berequired for human heart development, which modelorganism(s) would you choose? Describe two different experimental approaches you could use
In 2013 the actress Angelina Jolie elected to have prophylactic double-mastectomy surgery to prevent breast cancer based on a positive test for mutation of the BRCA1 gene. What are some potential positive and negative consequences of this high-profile example of acting on the results of a genetic test?
How do the egl-1 and pos-1 phenotypes interact? Do you think this is a meaningful genetic interaction? Why?
22. heterozygous mice for the Sd gene are shown to have relatively shorter or lack a tail true or false
M2
I need help please
61. Greene and colleagues studied Zonosemata flies to see if their wing displays and markings deterred spider predators. They set up five experimental groups, as shown below: A в D E Treatment Zonosemata untreated Zonosemata Zonosemata with housefly wings Housefly with Zonosemata wings Housefly untreated with own wings cut and reglued What is the purpose of group D in the preceding figure? a. To examine the effects of the markings alone. b. To examine the effects another prey item. c. To examine the effects of the behavior alone. d. To examine the combined effects of the markings and behavior. To control for the operation of removing the wings. 62. You are asked to determine plant species diversity in a prairie patch. To determine how many samples to take you construct a a. species-area; the curve intercepts the x-axis b. species-area; the curve reaches an asymptote c. species-area; the curve displays damped oscillations d. rank-abundance; the curve intercepts the x-axis e.…
can you explain how might you expect cell proliferation to change if LEF1 is deleted experimentally in a human gastric cancer cell line? also, name two additional analyses that could be performed to support/confirm that LEF1 is robustly upregulated in this gastric tumour?
Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively affect gene Xfunction in these three tissues map to three differentregions (A, B, and C, respectively) 5′ of the X codingregion.a. Explain the nature of these mutations.b. Draw a map of the X locus consistent with the preceding information.c. How would you test the function of the A, B, and Cregions?
In squirrels, individuals that are heterozygous for the mutant LDL receptor gene( Fa) begin to experience heart attacks at the squirrel equivalent of the 30’s and 40’s in humans, while individuals that are homozygous for the mutant LDL receptor allele experience heart attacks much earlier. Closer examination reveals that the hepatocytes of the homozygous normal squirrels contain ONLY normal receptors. In the hepatocytes of the heterozygous squirrels, 50% of the receptors are of the mutant type, and fail to bind the LDL cholesterol, while the other 50% are normal. In individuals homozygous for the mutant LDL receptor allele, only mutant receptors are present. NAME and DEFINE the genetic phenomenon observed here.
7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCICCGCICCCIGCGGCCGGAGGCTGAGAATAACCCCGGCCGCCCT 2. Human CCTGAAGAGCTACCICCGTICICIGCGGCCAGAGGCTGAGAATAATCCIGGCCGCCCI 3. Chicken CITGAAAAGCTACCIACGCTCICIGAGACCCGACGCIGAGAATAACCCTGGICGICCA 4. Cow CCTGAAGAGTTACCTCCGTTCCCIGCGGCCTGAGGCTGAGAATAACCCCGGCCGCCCT Answer: