A fusion protein can be synthesized to carry a specific tag, which is useful in identifying the proteins in various experiments. Fusion proteins with the FLAG epitope bind to specific anti-FLAG antibodies and carry this extra sequence: Asp-Tyr-Lys-Asp-Asp- Asp-Asp-Lys. a. Draw the structure of the FLAG epitope at pH 7.0. b. As you have drawn it, what is the approximate net charge of the FLAG epitope at pH 7.0? c. How would the structure and net charge of the FLAG epitope change if placed into a pH 12.5 solution?

A fusion protein can be synthesized to carry a specific tag, which is useful in identifying the proteins in various experiments. Fusion proteins with the FLAG epitope bind to specific anti-FLAG antibodies and carry this extra sequence: Asp-Tyr-Lys-Asp-Asp- Asp-Asp-Lys. a. Draw the structure of the FLAG epitope at pH 7.0. b. As you have drawn it, what is the approximate net charge of the FLAG epitope at pH 7.0? c. How would the structure and net charge of the FLAG epitope change if placed into a pH 12.5 solution?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein: ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA
Given the following complementation chart for holes in Monstera, give me the biochemical (phenotype) pathway. A В D E Holes Class 1 + + + - - Class 2 + + Class 3 + + + Class 4 Class 5 + + - - + +
How do loss of function mutations associated with Artemis (protein) cause their resulting phenotypes? Explain how genetically modified HSCs can treat these phenotypes.
both noncoding and coding). a. Which types of SNPs affect protein production or function for the gene of interest? b. Which types of SNPs might be identified in a GWAS? Biolnteractive.org (including Updated November 20% Page 1 of
please explain the figuer
What are Madin-Darby canine kidney (MDCK) cells? Are the MDCK cells from mice used to study viruses like Influenza /COVID 19?
Pinpointing a disease gene requires a combination of approaches. Mutations in the XIAP gene are known to cause a serious condition called X-linked lymphoproliferative disease (XLPD). In the case of XLPD, in which the blood contains too many lymphocytes (white blood cells of the immune system), crowding out the oxygen-carrying red blood cells and damaging the liver. When compairing the XIAP amino acid sequence of one affected patient to other human and animal standard RefSeq, the patient has an amino acid substitution at position 203, from cystenine (C) to tyrosing (Y). This evolutionary conservation suggests Group of answer choices that the standard RefSeq does not provide enough information to determine a possible cause of XIAP function. mutations in the XIAP gene and XLPD are not associated. that the mutation in the affected patient has no impact on XIAP function. that the mutation in the affected patient might alter XIAP function.
(d) Let's suppose that the exons encoding the binding site for the SARS-CoV-2 spike protein are widely spaced (the exons are far apart, the parts on the polypeptide are far apart-I made these up so if they coincide with your answers, it is by accident). As indicated below, exons 4.10 and 15 encode the parts of the protein (indicated by arrows) that interact with the spike protein. Exon 4 E10 E15 RNA (protein)_ N- Give TWO explanations as to how widely separated parts of a protein can interact with the spike protein. (I gave one in the class)
Knock out mice that are mutant for a gene product X die. Variants of the X gene that were reintroduced through homologous recombination indicate that variant proteins that lack the C-terminal region of the protein cannot rescue the lethality (did not allow them to live), and always localized to the cytoplasm. Those that retained the C-terminal region rescued the lethality (conferred viability!) and were consistently localized within the nucleus. RNA-seq analysis of the mutant cells vs the wild-type cells indicated that the expression of many genes that are essential for neural function was reduced in the knock-out mutant cells. The N-terminal region of Protein X is 100% conserved between mouse and humans at both the amino acid and the nucleotide level. The predicted mouse mRNA sequence is shown below where the AUG corresponds to the translational start site (AUG). 5’-AUGUUUACAGAGGGGAAU... -3’ d) What motif could be present to direct this protein to its correct destination? e)…
Knock out mice that are mutant for a gene product X die. Variants of the X gene that were reintroduced through homologous recombination indicate that variant proteins that lack the C-terminal region of the protein cannot rescue the lethality (did not allow them to live), and always localized to the cytoplasm. Those that retained the C-terminal region rescued the lethality (conferred viability!) and were consistently localized within the nucleus. RNA-seq analysis of the mutant cells vs the wild-type cells indicated that the expression of many genes that are essential for neural function was reduced in the knock-out mutant cells. The N-terminal region of Protein X is 100% conserved between mouse and humans at both the amino acid and the nucleotide level. The predicted mouse mRNA sequence is shown below where the AUG corresponds to the translational start site (AUG). 5’-AUGUUUACAGAGGGGAAU... -3’ Q3a) Using a total RNA sample obtained from human cells, what is the first primer you would…
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. What type(s) of mutation may have occurred in the GS1 gene in strain A?
Several DNA coding for different proteins, CRISPR, or siRNAs against different genes were expressed in cultured normal human somatic cells (A–G; “-” = control: no expression of exogenous gene/siRNA). The cells were either untreated (-) or irradiated to induce DNA damage (+). After 24 hours, the cells were harvested for preparing cell-free extracts. Different proteins were then detected using SDS-PAGE followed by Western blotting. These include p53, the phosphorylated form of pRb as well as total pRb, the phosphorylated form of lamin B as well as total lamin B, and caspase 3 (note that the darkness of the bands roughly corresponds to the intensity of the bands in the Western blot). Fig.1. The cells were also analysed using flow cytometry. The x-axis is DNA contents (2N represents the position of DNA as in G1 phase; 4N represents the position of DNA as in G2/M phase); the y-axis is the accumulated cell number. Fig.2. (1) The first four samples are known (the rest, see below, are all…