Use the sequence provided here to identify the tag and tag location for the encoded DHFR fusion protein:   ATATGCATCACCATCACCATCACATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATTAA

Q: 1. a)What would happen if the aminoacyl tRNA synthetase responsible for charging alanine tRNAs also…

A: The polymerization of amino acids according to the codons on mRNA to form proteins is known as…

Q: éxpressed by the genome. Proteomic analysis indicates that human cells are capable of synthesizing…

A: Gene expression means the protein which are going to be formed by the gene by the process of…

Q: Please help explain Angiotensin-converting enzyme 2 (ACE2) is a receptor for cell entry of…

A: Angiotensin II converting enzyme has the main role of degradation of Angiotensin II. It is the main…

Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…

A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…

Q: Name two similarities and two differences between the cellular processes of importing protien into…

A: A plasma membrane allows various molecules that a cell requires to pass through. Transport proteins…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 9. Generate a FULL protein sequence alignment for one of the…

A: Introduction  Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: Explain Synpolydactyly caused by mutations in the human HoxD13 gene.

A: Synpolydactyly (SPD) is a rare congenital distal limb malformation, which is characterized by the…

Q: Briefly explain how the oocyte precursor manages to transcribe enough rRNAs

A: Synthesis of ribosomal structural proteins has been studied in the developing occytes of the frog,…

Q: Which are the events causing loss-of-heterozygosity in somatic cells of RB+/RB− individuals?

A: The DNA (deoxyribonucleic acid) is the genetic material that is inherited by the progeny from the…

Q: What transcritpion factor is produced in the Nieuwkoop center in reponse to nuclear beta-catenin?(…

A: Transcription factors are usually the protein that have the capacity to increase or decrease the…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: Based on the BLASTp and Reciprocal hit analysis is mus musculus a true ortholog for the human fgfr3…

A: Ortholog genes are those genes which are present in different species but have a common ancestor.…

Q: These sequences are derived from the middle region of the covid-19 spike protein. Which choice or…

A: trypsin digest is used to cleave the proteins in a sample downstream to every K (lysine) or R…

Q: Sam wants to alter his interrupted mating experiment by placing a filter in between the donor and…

A: Introduction  Interupted mating is a technique for identifying bacterial genes that involves…

Q: The HbβS(sickle-cell) allele of the human β-globingene changes the sixth amino acid in the…

A: Sickle cell anemia is a blood disorder in which an improper folding of hemoglobin occurs. In this…

Q: Describe the functions of the RAG1 and RAG2 and NHEJ proteins.

A: Deoxyribonucleic acid (DNA) is a long molecule. DNA contains the instructions an organism required…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other…

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you…

Q: In the fX174 genome, describe the difference between how thegene B and gene A* proteins are made

A: fX174:- Craig venter and his group reported the genome of fX174 in in-vitro conditions. It is a…

Q: Explain how the presence of tryptophan favors the formation of the 3–4 stem-loop.

A: The stem-loop, an intramolecular base pairing, is the pattern that occurs commonly in the RNA or…

Q: How do I draw the sequence and explain the process for each step? Draw the sequence of molecular…

A: In the nucleus, the STAT dimers localise and bind to specific DNA targets and induce gene…

Q: A certain cDNA of size 2 kb hybridized to eight genomicfragments of total size 30 kb and contained…

A: Introduction :- In the presence of reverse transcriptase, cDNA is a complementary DNA to a given RNA…

Q: Mark promoter and terminator

A: DNA, or deoxyribonucleic acid, is the genetic material that carries the instructions for the…

Viral Infections

Viruses are abundantly found, minute entities that have genetic material enclosed within a protein coat. The proteinaceous material enclosing the genetic material of the virus is called a capsid. The genetic material could be either DNA (deoxyribonucleic acid) or RNA (ribonucleic acid). A virus is too minute to be looked at with naked eyes and therefore visualized with the help of a microscope. They are acellular entities that require a host for processes, such as replication, transcription, translation and multiplication. Plants, animals, and bacteria act as host wherein the virus reproduce. Viruses cannot multiply outside the host's body and thus are considered nonliving outside the host body.