ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA  Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has no impact on the length of the mRNA transcribed from the gene.

Q: Why most loss-of-function mutant alleles are recessive to wild-type alleles

A: The loss-of-function mutations are also known as inactivating mutations that result in the gene…

Q: This pedigree depicts the inheritance of the mitochondrial disease Leber hereditary optic neuropathy…

A: Inheritance through mitochondria is a special type of inheritance. The genetic deformity is in…

Q: Explain the equation E+S---->ES----> E + P.

A: Given equation,  E+S---->ES----> E + P E = Enzyme S= Substrate P= Product Enzyme is required…

Q: What is the probability that one of their daughters would be colorblind? O 1/4 O 3/4 O 1/2

A: It is given that the disease is X linked recessive.  Let us denote the diseased allele for…

Q: A heterozygous null (X+/XA) is most likely to have what type of phenotype: mutant O wild-type

A: The field of genetics is a fascinating area of study that explores the inheritance, variation, and…

Q: which are the two genes are said to be syntenic?

A: Genes are the basic structural and functional units of heredity. They are composed of…

Q: Define wild-type alleles (+)

A: Wild type allele is the phenotype of the organism that is the product of standard normal alleles.…

Q: ___________________ alleles are always expressed in the presence of another allele.     recessive…

A: Alleles are two alternative forms of a gene.  Alleles can be dominant or recessive. Dominant -…

Q: individual male or female? How do you know? Was there anything unusual about your Karyotype?…

A: Human sex is mainly two types, male and female. Identification based on in general through…

Q: Alternate form of the same genes are called

A: The body cells contain pairs of homologous chromosomes. The two chromosomes of each pair have the…

Q: Sickle cell disease— what is the background of this disorder: include the name of the disorder, any…

A: Sickle cell disease is a genetic condition characterized by abnormal hemoglobin in red blood cells.

Q: The ABO blood group is inherited in a(n) X-linked codominance incomplete dominance pattern.

A: The ABO blood group system involves three main alleles: A, B, and O. These alleles determine the…

Q: QUESTION 3 In the pedigree below, all shaded individuals express the gene in question. For example,…

A: In the given pedigree, there are cases where it skips generation. For example, Ann and Michael do…

Q: 99A II MOD FOMI Create a dihybrid cross and determine the expected phenotypic percentages of the…

A: Two qualities are present in this instance. One of them is colour and let “R” indicating dominant…

Q: Autosomal Recessive Inheritance (trait only expressed if homozygous recessive)An albino man (nn)…

A: Autosomal recessive trait only gets expressed when they are present in homozygous recessive…

Q: phenylketonuria, which is an autosomal recessive mutant allele. The father is homozygous for this…

A: Phenylketonuria is an autosomal recessive mutant allele,  lets say, Homozygous allele for…

Q: Using the pedigree below for an autosomal dominant disorder to determine the phase (which ones are…

A: Pedigree analysis is a valuable tool for understanding the inheritance patterns of genetic…

Q: What is Trisomy test?

A: The chromosomes are the thread like structure that contains hereditary information in the form of…

Q: Gene A and gene B are two linked geres uwhich are separated bg 15CM. A women with the genokype aaob…

A: The genetic distance between two genes suggests the recombination frequency between two genes.

Q: Recessive hemophilia, x-linked. The man has it, and his wife is a carrier. Draw a Punnett square to…

A: Given: Hemophilia is a recessive, x-linked disorder. Man has it (XhY) Wife is a carrier (XHXh) (XhXh…

Q: Using the pedigree you have constructed, complete the following Punnett square using A/a. 1) Show…

A: A pedigree depicts family relationships and identifies which members of a family have certain…

Q: Give the F1 genotypes of  GgXHXh    and      GgXhY

A: Genotype is the representation of genetic constitution in the form of allelic combinations.…

Q: Q5. When Mendel crossed a large number of tall pea plants with short pea plants, all F1 plants were…

A: Gregor Mendel is known as the father of genetics who studied how inherited traits are passed between…

Q: can two observably different cells have the same geno type, explain?

A: In biology, the genotype is the set of genes in our DNA which is responsible for a particular trait.…

Q: >chromosomal…

A: Codons are trinucleotide sequence that codes for specific amino acids and there are totals of 64…

Q: determining coat color is the agouti gene?

A: The coloration, pattern, and length of the cat fur is governed by numerous genes and is determined…

Q: Can two polydactylic people have a child without polydactyly? Please explain.

A: Polydactyly is a condition in which a baby is born with an additional finger or toe on each hand or…

Q: Sex Determination (female genotype XX and male genotype XY) A. What fraction of human offspring…

A: A sex-determination system is a biological system that controls how an organism's sexual…

Q: For the cell line H9c2(2-1) which is a rat mycardium cell line, what disease was it derived from?

A: The cell lines are inherited from different sources and hence keep distinct properties.

Q: In a parental cross for an autosomal MOI, the ratio (Disease phenotype):(WT phenotype) differ for…

A: The alleles are the alternative forms of a gene that are located in on the same locus of a…

Q: Dominant vs. Recessive genes

A: The fundamental physical and functional unit of heredity is the gene.

Q: Refer to the dihybrid cross shown. The genotype represented by the cell labeled "5" is? OGgli gi GI…

A: The given square boxes in the question is known as punnet square which shows all possible genotype…

Q: Did you mean 0.000034 instead of 0.000024

A: NADPH Nicotinamide adenine dinucleotide phosphate abbreviated NADP+ or NADPH is an essential…

Q: Complementation tests are performed in the (F1/F2/dominant/recessive/affects/does not affect)…

A: Complementation test is a genetic test which is used to check the presence or absence of a…

Q: Discuss and compare the source (mechanism) and types of increased mutations in older mother oocytes…

A: Germline mutation are the mutations that  are present in parent's egg or sperm cells. When an egg…