ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAA  Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has no impact on the length of the mRNA transcribed from the gene.

Q: Unequal crossing-over can increase ordecrease ___________- number

A: The genetics is the branch of biology that deals with the study of genes, genetic variation and…

Q: _____________________ describes the imbalance in genetic information due to the removal of controls…

A: Cell cycle checkpoints are control mechanisms in the eukaryotic cell cycle which ensure its proper…

Q: term for random alignment of the homologs along the metaphase plate of meiosis

A:

Q: Hemophilia results from a sex-linked gene. The disease is most common in males, but the hemophilia…

A:

Q: ___________ chromosome aneuploidy is usually welltolerated because only one X chromosomeremains…

A: Step 1 Aneuploidy (Heteroploidy) is a numerical change in the chromosome number in the genome or…

Q: Understanding x - linked dominant/ recessive inheritance patters

A: X-linked inheritance is specifically a sex linked inheritance where the trait inheritance within the…

Q: Mr. and Mrs. Smith, both 40 years of age, are healthy with no knowngenetic conditions. Their newborn…

A: Down syndrome is defined as the condition in which an individual contains an extra chromosome. In…

Q: Can two polydactylic people have a child without polydactyly? Explain.

A: It is otherwise called hyperdactyly, is an irregularity in people and creatures bringing about…

Q: Identify each of the numbered structures

A: There are total 11 venous sinuses that remain located in the falx cerebri. These venous sinuses are…

Q: identify and label the chromosomes number (1-22). also, identify if it is male or female by labeling…

A: A karyotype is a preparation of the entire complement of metaphase chromosomes found in a species or…

Q: Jane (mother): Tt XcXc IBi -Taster, Color-blind female, Blood type B John (father): tt XcY IAIB-…

A: Colour blindness Colour blindness is a genetic disease. In this disease the person is unable to see…

Q: Identify the indicated labeled structures in the photo: A B Caudal ahial

A: Anatomy: The study of the bodily structure of people, animals, and other living beings, particularly…

Q: Jacob and Patau Syndromes List the similarities and differences between these two syndromes. Which…

A: Jacob syndrome: Also known as XYY syndome/ XYY karyotype/ YY syndrome Patau syndrome:  Also known as…

Q: 3 4. 11 12 13 14 15 18 19 21 22 Y 2. 20

A: Karyotyping is the process by which photographs of chromosomes are taken in order to determine the…

Q: Explain the Syndromes from AbnormalChromosome Numbers ?

A: Chromosomes are thread-like structures present inside the nucleus of the cell. They are made up of…

Q: Why is autosomal Monosomy lethal?

A: Most living species have DNA as their genetic material. It is the cell's information centre,…

Q: are all genetic disorders inherited

A: Genetic disorders are diseases that are inherited genetically. Genetic disorder can be caused due to…

Q: xplain the incomplete penetrance and its causes.

A: Penetrance is the frequency with which one of a gene's alleles expresses itself, resulting in the…

Q: Maria (AA-) and Jason (AB+) Phillips had twins, a boy and a girl. Lily (AO-) and Charles (AO-) Smith…

A: The ABO blood group system is present in the human. There are four blood groups in the ABO blood…

Q: The M97 allele of the BRCA1 gene is a rare autosomal dominant allele that is only 20% penetrant in…

A: Breast cancer is characterized by abnormal growth of breast tissues. Inverted nipple, change in the…

Q: Why does an Hfr * F- mating not yield two Hfr cells?

A: Conjugation is the process of genetic material transfer between two bacterial cells through direct…

Q: Translocations ___________ Part of OneChromosome to Another Chromosome

A: Chromosomes are thread-like structures that are located in the nucleus. It is composed of protein…

Q: ivision into 2 identical cells?

A: Cell division is a very important process that is required for the growth and development of an…

Q: What is incomplete penetrance and what causes it?

A: Introduction  Any gene have two alleles pairs viz. Dominant or Recessive. The allele which gets…

Q: Why is X chromosome inactivation important in female cells? (300 word limit)

A:

Q: Gene A and gene B are two linked geres uwhich are separated bg 15CM. A women with the genokype aaob…

A: The genetic distance between two genes suggests the recombination frequency between two genes.

Q: K.S. comes for a clinic visit to determine whether she is pregnant. She is very concerned because…

A: To get the remaining sub-parts solved, please repost the complete question and mention the…

Q: Can a son be a carrier for an X-linked trait? Explain.

A: The genetic makeup of an offspring is determined by the genetic makeup of both parents; that is, the…

Q: Define retroversion

A: The female reproductive system includes the following organs: The ovaries The uterine (fallopian)…

Q: mutations in genes on the numbered chromosomes (1-23 O Dominant Disorder Autosomal disorder…

A: In human there are  23 pairs of chromosomes present in the cell. Among these 23 pairs, 22 pairs are…

Q: Explain the inactivation of the X chromosome or Lyonization.

A: A classic example of X inactivation is seen in calico cats. As a result tortoiseshell coat pattern…

Q: why the negative control sample (from an unaffected individual) only produced one band.   b.…

A: Huntington's Disease It is a rarer disorder where the brain cells or the neurons starts degenerating…

Q: Analyze the karyotype shown. Indicate if it is a chromosomal male or achromosomal female. If the…

A: Most higher animals show sexual dimorphism so, a individual can be either male or female. In…

Q: Can two polydactylic people have a child without polydactyly? Please explain.

A: Polydactyly is a condition in which a baby is born with an additional finger or toe on each hand or…

Q: Part A What is the probability that the first son of a woman whose brother has Lesch-Nyhan syndrome…

A: Lesch Nyhan syndrome is X linked recessive disorder. Normal = XX, XXn, XY Affected = XnXn, XnY

Q: Number of FEMALE offspring that would have the condition of an X-linked trait, if an affected man…

A: The mode of inheritance is a pattern of obtaining parentral alleles  or genes to the offsprings. The…

Q: is AC genotype normal?

A: Genotype refers to the genetic constituation of an organism. The genotype in humans are AA, AS, AC,…