5' 3' O Top strand 5' O Bottom strand Primer 1 ORF Primer 2 5' 3' You have designed primers to amplify an ORF (gray box). The primers are labeled in red (Primer 1 and Primer 2) with their 5' ends labeled in red. Each primer can anneal/hybridize to the sequence of one of the two DNA strands. To amplify the indicated ORF, which strand of DNA must Primer 1 anneal/hybridize to? 5'

5' 3' O Top strand 5' O Bottom strand Primer 1 ORF Primer 2 5' 3' You have designed primers to amplify an ORF (gray box). The primers are labeled in red (Primer 1 and Primer 2) with their 5' ends labeled in red. Each primer can anneal/hybridize to the sequence of one of the two DNA strands. To amplify the indicated ORF, which strand of DNA must Primer 1 anneal/hybridize to? 5'

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…

A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…

A: The region of DNA known as the replication fork is where the replication process itself is now…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: DNA polymerase I DNA polymerase II DNA ligase Primase RNA primer 5' Lagging strand 3' 3' Okazaki…

A: The process of copying of double stranded DNA by the application of several Enzymes and proteins…

Q: The DNA sequence below is used by the primase to synthesize a primer. What is the sequence of the…

A: The primer of this sequence will be complementary to it. The complementary bases are as follows: A…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?

A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…

Q: Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four…

A: Palindromic DNA sequences are read the same on both DNA strands from the similar end. For example,…

Q: How often, on average, will the endonuclease AluI, which cleaves the sequence 5’ AGCT 3’, cut normal…

A: Enzyme restriction, also referred to as endonuclease restriction, is a protein formed by bacteria…

Q: Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, sugar…

A: On one side of the helix, the strand backbones are closer together than on the other. When the…

Q: A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the…

A: The DNA is made up of nucleotides that contain nitrogenous bases, pentose sugar and phosphate group.…

Q: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

A: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

Q: why H is 5' and E is 3'.

A: DNA replication is the process through which cells make copies of the genome's DNA. A cell must…

Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…

A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…

Q: How is DNA copied with leading and lagging strands? Please use these terms in a summary: Helicase…

A: DNA is the molecule which comprises of two polynucleotide chains that wound around each other for…

Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…

A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…

Q: Assume complete digestion of a single linear piece of DNA digested (cut) with EcoRI and Hindill.…

A: A plasmid is a single-stranded, circular DNA molecule that is different from the chromosomal DNA of…

Q: 3' Shown is a segment of DNA about to be replicated. a) What is the sequence of the complementary…

A: DNA replication is a biological process that occurs in all living organisms and is the basis for…

Q: Which primer would bind to this coding strand as a reverse primer? 5' - ATGGCCAAAT GATTCCCACG…

A: Primers are very short sequences of nucleotides (usually 18 to 22 nucleotides) that play an…

Q: 5' 3' O Top strand 5' O Bottom strand Primer 1 ORF Primer 2 5' 3' You have designed primers to…

A: In DNA, the two strands are antiparallel, meaning they run in opposite directions. The top strand…

Q: None

A: Detailed explanation: 1. Digital Image of Gel and LabelingTo obtain and label a digital image of…

Q: The function of the 3'-> 5' exonuclease activity is found in which of the following: DNA Polymerase…

A: E. Coli has three types of DNA polymerases which are little different from each other. But all of…

Question

5'
3'
O Top strand
5'
O Bottom strand
Primer 1
ORF
Primer 2
5'
3'
You have designed primers to amplify an ORF (gray box). The primers are labeled in red (Primer 1
and Primer 2) with their 5' ends labeled in red. Each primer can anneal/hybridize to the sequence of
one of the two DNA strands.
To amplify the indicated ORF, which strand of DNA must Primer 2 anneal/hybridize to?
5'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Strands of DNA

VIEW

Step 2: DNA amplification

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Follow-up Questions

Read through expert solutions to related follow-up questions below.

Follow-up Question

this is for primer 2 not primer 1

Solution

by Bartleby Expert

SEE SOLUTION

Similar questions

Following base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true or False? Why? please help me explain that
5² | 1. Draw on the first 4 RNA primers and label the 3'OH ends 2. Identify what will be leading and lagging strands 5'
Please in detail, what the picture attached represents
Referring to Figure 17-26, draw the product if breaks occurred within genes A and B
5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
The phenomenon where double-helical DNA absorbs UV light less than does single-stranded DNA is referred to as intercalation hyperchromism hypochromism base-stacking None of the these are correct.
All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.
Explain why cuts are made on both sides of the damaged region of the DNA.
3' 5' a b. 5' d 3' e f a 5' 3' 3' 5' What enzyme should be at location "c" to synthesize DNA after the primer? in