Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 5, Problem 33P
DNA sequence for
Identify the nucleotide positions of all SNPs ( single nucleotide polymorphisms).
How many different SNP haplotypes are represented in the data?
What is the sequence of each haplotype?
Identify the haplotype carried by each person.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Using figure 1 and the following background information answer the following questions.
Identification of the genetic cause of hornlessness in cattle has been the subject of intensive genetic and genomic research, culminating in the nomination of two different candidate neomutations on cattle chromosome 1 that are predicted to have arisen 500-1,000 years ago: a complex allele of Friesian origin (PF), an 80,128 base pair (bp) duplication (1909352–1989480 bp), and a second, simple allele of Celtic origin (PC) corresponding to a duplication of 212 bp (chromosome 1 positions 1705834–1706045) in place of a 10-bp deletion (1706051–1706060)We report the use of genome editing using transcription activator-like effector nucleases (TALENs) to introgress the putative PC POLLED allele into the genome of bovine embryo fibroblasts to try and produce a genotype identical to what is achievable using natural mating, but without the attendant genetic drag and admixture. In our previous studies, we…
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided:
(a) How can you develop a simple molecular test to identify the genetic disorder (based on the information above) ?
(b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel ?
*note: the carrier means : (bb), I mean the diseased individuals who are carriers of the bb genotype.
Chapter 5 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 5 - For parts a, b, and c, draw a diagram illustrating...Ch. 5 - 5.2 In a diploid species of plant, the genes for...Ch. 5 - A pure-breeding tall plant producing oval fruit as...Ch. 5 - 5.4 Genes E and H are syntenic in an experimental...Ch. 5 - In tomato plants, purple leaf color is controlled...Ch. 5 - 5.6 In Drosophila, the map positions of genes are...Ch. 5 - 5.7 Genes A, B, and C are linked on a chromosome...Ch. 5 - Gene G recombines with gene T at a frequency of...Ch. 5 - Genes A, B, C, D, and E are linked on a...Ch. 5 - Syntenic genes can assort independently. Explain...
Ch. 5 - 5.11 The recombination frequency between linked...Ch. 5 - On the DrosophilaX chromosome, the dominant allele...Ch. 5 - Researchers cross a corn plant that is pure -...Ch. 5 - 5.14 syndrome is an autosomal disorder affecting...Ch. 5 - 5.15 Three dominant traits of corn seedlings,...Ch. 5 - 5.16 In a diploid plant species, an with the...Ch. 5 - Prob. 17PCh. 5 - The Rh blood group in humans is determined by a...Ch. 5 - 5.19 Genetic linkage mapping for a large number of...Ch. 5 - 5.20 with the genotype form tetrads in the...Ch. 5 -
Gene and gene are genetically linked. Answer...Ch. 5 -
T. H. Morgan’s data on eye color and wing form,...Ch. 5 - Prob. 23PCh. 5 -
The boss in your laboratory has just heard of a...Ch. 5 - In rabbits, chocolate-colored fur (w+) is dominant...Ch. 5 - Prob. 26PCh. 5 - 5.27 In tomatoes, the allele for tall plant height...Ch. 5 - 5.28 Neurofibromatosis is an autosomal dominant...Ch. 5 - A 2006 genetic study of a large American family...Ch. 5 - 5.30 A experiment examining potential genetic...Ch. 5 - A genetic study of an early onset form of heart...Ch. 5 - In experiments published in 1918 that sought to...Ch. 5 - DNA sequence for 10 individuals are Identify the...Ch. 5 - 5.34 The accompanying pedigree below shows a...Ch. 5 - 5.35 Based on previous family studies, an...Ch. 5 - Divide a clean sheet of paper into four quadrant...Ch. 5 - 5.37 For six genes known to be linked on chromosme...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.arrow_forwardPeople who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence.People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gelarrow_forwardWhat is the Philadelphia chromosome? How is this chromosome related to cancer? Identify how this chromosome appears physically different in a karyotype than it appears in a normal karyotype. Include references to information sources used.arrow_forward
- DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single microsatellite locus, and run on an agarose gel. The results from gel electrophoresis shows three different fragment lengths (i.e. alleles/band positions) corresponding to 3 alleles; Allele F (250bp), Allele R (180bp), and Allele Y (100bp). The numbers at the top of each lane is the number of fish observed with that particular genotype or banding pattern in the population. Note that a single band means a homozygote for that allele (band size). a) Calculate the allele frequency for Allele Y. (b) Calculate the genotype frequencies for the following genotypes: FF, FR, and RY. (c) What is the expected number of Chinook salmon with homozygous genotype for allele Y in the study population? (d)What is the name of the statistical test that you could conduct to test whether this population of Chinook salmon is in Hardy Weinberg Equilibriumarrow_forwardCalculate the number of Alu elements present in the haploid human genome based on the number of Alu elements present in the clones analysed by the entire class. You will need to know the total length of DNA analysed and the number of Alu elements present. For the entire class, 57 Alu elements are present in 174,204 bp.arrow_forwardI) Indicate 2 differences between SSLP (simple sequence length polymorphism) and SNP (single nucleotide polymorphism)arrow_forward
- Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OHarrow_forwardPeople who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATTC to GGATTC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder? (b) If you have carried out the molecular test (based on the information above) on a 100 individuals and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel.arrow_forwardUsing the figure and the following background information answer the following questions about the figure Background: Identification of the genetic cause of hornlessness in cattle has been the subject of intensive genetic and genomic research, culminating in the nomination of two different candidate neomutations on cattle chromosome 1 that are predicted to have arisen 500-1,000 years ago: a complex allele of Friesian origin (PF), an 80,128 base pair (bp) duplication (1909352-1989480 bp), and a second, simple allele of Celtic origin (PC) corresponding to a duplication of 212 bp (chromosome 1 positions 1705834-1706045) in place of a 10-bp deletion (1706051-1706060)We report the use of genome editing using transcription activator-like effector nucleases (TALENs) to introgress the putative PC POLLED allele into the genome of bovine embryo fibroblasts to try and produce a genotype identical to what is achievable using natural mating, but without the attendant genetic drag and admixture. In…arrow_forward
- Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lysarrow_forwardWrite the number of each variation for the remaining STR loci to create a DNA profile of this person: STR Locus Variation number(s) D3S1358 14, 15 THO1 D21S11 D18S51 Penta Earrow_forwardGiven the Percentage Composition of One Nucleotide ina Genome, Can We Predict the Percentages of the OtherThree Nucleotides?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license