Which of the following statements is TRUE of highly repetitive sequences? O They can be found millions of times in a eukaryotic genome. O They typically increase fitness of the organism. O They play a vital role in translation. O They play a vital role in transcription.

Which of the following statements is TRUE of highly repetitive sequences? O They can be found millions of times in a eukaryotic genome. O They typically increase fitness of the organism. O They play a vital role in translation. O They play a vital role in transcription.

Name: Which of the following statements is TRUE of highly repetitive sequen
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following statements is TRUE of highly repetitive sequences?O They can be found millions of times in a eukaryotic genome.O They typically increase fitness of the organism.O They play a vital role in translation.O They play a vital role

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

Polypeptides can be reversed back to RNA because of the enzyme transcriptase. The genetic material must be replicated with high fidelity and great speed. Eukaryotic mRNA is said to be polycistronic since they encode multiple polypeptide chains RNA-synthesis occurs inside the nucleus while protein synthesis in the cytoplasm of eukaryotic organisms. Write T if the statement is true and write F if the statement is false
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
The following is a prokaryotic DNA sequence. Fill in the other strand of DNA. Be sure to label the ends appropriately (5’ and 3’). Transcription goes from left to right and stops after the right most base pair. On your DNA, indicate which is the coding/partner and which one is the template. Write out the pre-mRNA transcript. Be sure to label the ends appropriately (5’ and 3’). DNA 5’ – T G G G G G A T A C C G C A T G C A G G T A G T C T A A G C G A G T G A C – 3’ DNA mRNA
Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
In cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein]. DNA with mRNA mRNA with tRNA mRNA with rRNA rRNA with tRNA A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino acid uses combinations of 3 RNA bases as letters, each triplet can specify more than one amino acid uses combinations of 3 DNA bases as letters to specify the amino acids uses combinations of 3 tRNA bases as letters to specify the amino acids
Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence reads? Select all that apply. Near the end of a read (which is typically about 500-700 bp in length); DNA polymerase will nearly always incorporate a ddNTP into a read when it reaches this length. Anywhere a mutation leads to incorporation of a translation stop codon in the DNA; DNA polymerase is unable to incorporate ddNTPs into this sequence Anywhere the candidate differs from the reference sequence; any deviation from the reference sequence will inhibit the ability of the sequence analyzer to correctly interpret the base In the first 25-100 base pairs of the read; ddNTPs are unlikely to be incorporated in this region because they are greatly outnumbered by dNTPs.
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.
Which of the following mutations would be most likely to have the most negative effect on the functioning of a protein produced by the gene? Group of answer choices a deletion of one nucleotide at the beginning of the coding sequence a substitution of one nucleotide at the beginning of the coding sequence an insertion of three nucleotides near the end of the coding sequence a substitution of one nucleotide near the end of the coding sequence
Several different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNA