The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGССАAGTTGGGGАТАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the end.

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGССАAGTTGGGGАТАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the end.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
The following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)
The following sequence is the coding strand of a piece of DNA. Type out the corresponding template strand of DNA and the MRNA that could be made from this piece of DNA if you assume that transcription begins at the first nucleotide listed. Next, use the attached genetic code table to translate the mRNA into a polypeptide that could be made from the message and list that sequence along with those of the DNA and MRNA. Coding strand 5'-TACCGTATGATTCTCTTGTATGGGTAACC-3' Second letter U UUU UUC UCU UAU UGU Phe Tyr Cys UCC UCA UAC UAA STOP UAG STOP UGG| Trp UGC Ser UUA UGA STOP A UUG Leu UCG CUU CCU CC CAU CGU CGC His CUC C CUA CAC САА Leu Pro Arg CCA CGA Gln CUG СCG CAG CGG AGU Ser AAU AAC ACU AUU lle AUC Asn ACC ACA AGC Thr AAA AGA AUA AUG Met Arg ACG AAG Lys AGG GAU GCU GCC GUU GGU Asp GAC GGC GGA GUC Val Ala Gly GCA GCG GAA GAG GUA Glu GUG GGG Third letter UCAG UCAG 5CAG UCAG First letter
What would be the percentage of G, C, A, and T in each column? Have to calculate the nucleotide frequency from my sequence.
You discovered a (tiny) novel protein and figured out that the protein sequence was: Met-Ala-Arg-Gly-Trp-Ala-Pro Work backwards (showing your work) to identify 2 possible DNA sequences that might encode your protein. Sequence 1: ______________________________________________________________________ Sequence 2: ______________________________________________________________________ Based on these sequences, is there anything you could infer about where this organism might live? Could the DNA in your possible sequences be beneficial for any particular environments?
You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codons
Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGA
Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000 (include the comma)
Write the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCAT
Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC
Figure 3 represents one process that occurs during protein synthesis. amino acid molecule Q A UGC C GỤ AC C GAC Ų (a) Name the process shown. (b) Identify the molecule labelled Q. (c) In Figure 3, the first codon is AUG. Give the base sequence of the complementary DNA base sequence and the missing anticodon. Table 1 shows the base triplets that code for two amino acids. Table 1 Amino acid Encoding base triplet Aspartic acid GAC, GAU Proline CCA, CCG, CCC, CCU Aspartic acid and proline are both amino acids. (d) Describe how two amino acids differ from one another. You may use a diagram to help your description. (e) Deletion of the sixth base (G) in the sequence shown in Figure 3 would change the nature of the protein produced but substitution of the same base would not. Use the information in Table 1 and your own knowledge to explain why.