Using the chart below, what type of mutation would take place if the highlighted and underlined "A" was deleted? What amino acid sequence would be coded for with this mutation? What would be the affect of this mutation on the organism? DNA AAT СТА GTA MRNA UUA GAU CAU Amino acid Leu Asp His

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…

A: Information in the gene tell the cell to make a particular protein. This information is encoded in…

Q: Match the mutation with the correct name. Not all labels are used. Nonsense Mutation Mismatch…

A: Any change in the DNA sequence is known as mutation. Some of the mutations are responsible for…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: What are the particular changes in the gene and protein sequences shown on the screen? Name the…

A: Mutation is the sudden change of a gene or chromosome from one to another. position 3 wild type…

Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…

A: Missense Mutation:  A missense mutation is a point mutation that results in a codon that codes for a…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Below is a segment of RNA, transcribed from a DNA sequence. Provide an example of each kind of…

A: Any detectable, inheritable qualitative or quantitative change in genetic material of an organism…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: If the wild-type codon is GUU, which of the following single-nucleotide polymorphisms lead to a…

A: Understanding the impact of single-nucleotide polymorphisms (SNPs) on amino acid sequences is…

Q: If the DNA sequence that coded for a codon that was complimentary to the ANTICODON AAU underwent a…

A: A mutation may be a change within the sequence of DNA. Mutations can occur as a result of the term…

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: Now imagine that a mutation occurred at the first G in the DNA sequence above and the G became a C.…

A: Hello, thank you for your question, since you have not mentioned the DNA orientation I am answering…

Q: Consider the following mRNA sequence: 5'-UUG ACC GAC-3'. Note: Reference the Genetic code table for…

A: The original mRNA sequence:5'-UUG ACC GAC-3'To determine the amino acid sequence, it is important to…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the…

A: The central dogma of molecular biology describes the flow of information in biological systems.  It…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.