To study genes that create the purple flower color in peas, you isolate 4 amorphic mutations. Each results in a flower with a different color, described mutant a = blue mutant c = pink mutant b = white mutant d = red A. In tests of double mutants, you observe the following phenotypes: mutants a and b = blue mutants b and c = white mutants c and d = pink Assuming you are looking at a biosynthetic pathway, draw the pathway indicating which step is affected by each mutant. B. What is the expected flower color of a double mutant of a and c?

To study genes that create the purple flower color in peas, you isolate 4 amorphic mutations. Each results in a flower with a different color, described mutant a = blue mutant c = pink mutant b = white mutant d = red A. In tests of double mutants, you observe the following phenotypes: mutants a and b = blue mutants b and c = white mutants c and d = pink Assuming you are looking at a biosynthetic pathway, draw the pathway indicating which step is affected by each mutant. B. What is the expected flower color of a double mutant of a and c?

Name: To study genes that create the purple flower color in peas, you isolat
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: To study genes that create the purple flower color in peas, you isolate 4 amorphic mutations. Each results in a flower with a different color, describedmutant a = bluemutant c = pinkmutant b = whitemutant d = redA. In tests of double mutants, you obs

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section15.1: The Connection Between Dna, Rna, And Protein

Problem 1SB

See similar textbooks

Similar questions

The intermediates A, B, C, D, E, and F all occur in the same biochemical pathway G is the product of the pathway, and mutations 1 through 7 are all G –, meaning that they cannot produce substance G. The following table shows which intermediates will promote growth in each of the mutants. Arrange the intermediates in order of their occurrence in the pathway at which each mutant strain is blocked. A “+” in the table indicates that the strain will grow if given that substance, an “o” means lack of growth.
Schizosaccharomyces pombe, also known as "fission yeast," is a powerful model organism in molecular and cell biology. While performing a genetic screen, you discover an auxotrophic S. pombe strain that is unable to synthesize one or more vitamins. The following table represents the key experiments you performed during your genetic screen. Fill in the table with the outcome of each experiment for your mutant strain (using + for growth and - for no growth). Medium Rich media Minimal media Minimal media + all vitamins Minimal media + all amino acids Growth Wild-type + + + + Mutant + + + > > >
The synthesis of flower pigments is known to be dependent on enzymatically controlled biosynthetic pathways. For the crosses shown here, postulate the role of mutant genes and their products in producing the observed phenotypes: (a) P1: white strain A * white strain B F1: all purple F2: 9/16 purple: 7/16 white (b) P1: white * pink F1: all purple F2: 9/16 purple: 3/16 pink: 4/16 white
You have isolated 8 mutants in yeast that fail to grow on minimal media plates but do grow when they are supplemented with Arginine. You know that Arginine is synthesized in a biochemical pathway within wild-type yeast, but you do not know how many gene products it takes for the pathway. You have all of the lines as both a and a cells and mate each strain to each other in pairwise crosses and plate them on minimal media to see if they grow. You obtain the following results with (+) representing growth, and (-) indicating no growth: a 1 5 1 a 4 5 6 7 8 How many genes are represented? O 1 3 7 O Cannot tell from the data a + + + + + • + + i 0 +, + + + • + + 7 + + + + + , . + + + + + m + + + + + + + 2 + + + + + i + -I + + . . + + +
Assume that a series of compounds has been discovered in Neurospora. Compounds A–F appear to be intermediates in a biochemical pathway. Conversion of one intermediate to the next is controlled by enzymes that are encoded by genes. Several mutations in these genes have been identified and Neurospora strains 1–4 each contain a single mutation. Strains 1–4 are grown on minimal media supplemented with one of the compounds A–F. The ability of each strain to grow when supplemented with different compounds is shown in the table (+ = growth; o = no growth). Which biochemical pathway fits the data presented? Media Supplement Strain A B C D E F 1 o o o + + + 2 o o o o + + 3 o o o o + o 4 o o + + + + A) A → B → C → D → E → F B) A → B → C → F → D → E C) F → B → C → D → A → E D) A → B → C → D → F → E E) A → B → F → E → C → D
What type of mutation is C c?
A mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is in the geneencoding isocitrate lyase?
The table below shows different types of mutations in different positions in four genes. Choose the letter (A to E), from the drop-down menu, that represents the most likely type of protein that will be produced from each of these mutated genes. A: completely normal protein B: functional protein with ONE amino acid different from normal C: non-functional protein with ONE amino acid different from normal D: non-functional protein with MANY amino acids different from normal E: no protein at all Answer Type of mutation Position of mutation in gene (A, B, C, D, or E) before the part of the gene that specifies the active site of the enzyme 2 base pair insertion Inonsense immediately before the stop codon in the part of the gene that specifies the active site of the enzyme silent 1 base pair insertion in an intron
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Auxotrophic mutation 103 grows on minimal medium supplemented with A, B, or C; mutation 106 grows on medium supplemented with A or C, but not B; and mutation 102 grows only on medium supplemented with C. What is the order of A, B, and C in a biochemical pathway?
You are interested in studying a unique protein found in a rare wildflower found in the desert region of Atacama. The wild-type amino acid sequence isolated from this flower is: Wildtype: Arg-Lys-Thr-Leu-Gly-Arg A mutant for the gene that specifies this protein is isolated and the amino acid sequence of its protein is determined: Mutant: Arg-Lys-Thr-Leu-Gly-Gly a) Identity what the mutation changed in the amino acid sequence b) What is the effect of the mutation at the amino acid level? c) What is the effect of the mutation at the RNA level? d) What kind of mutation happened at the DNA level?
In this problem, just put the order of the intermediates on the pathway, starting with P and ending with Z and explain your reasoning. (So to get you started, notice the class 1 mutants—and there is only mutant in this class, which is mutant #5—won’t grow on minimal medium, but will grow if you give it substance Z. However, giving it substances, p, w, x, or y won’t help. This means that the gene that is mutated lies on the pathway in a place that the Z substances is to its right and all the other substances are to its left. The easiest next one to look at is the line with 2 pluses, and then the line with 3 pluses, and then the line with 4 pluses).