1- modificarea materialului genetic 2- X şi Y sunt..Cramozoni 3- totalitatea factorilor ereditari formează. 4- factori fizici ce produc mutaţii 5- legea purităţii 6- capacitatea indivizilor de a se deosebi
Q: Resting membrane potential (assume the following initial conditions; EK = -81 mV, ENa = 58 mV, b =…
A: a) is correct: In order to preserve the resting membrane potential, the Na+/K+ ATPase pump actively…
Q: Eight mutant strains of flowers were found to have white petals. Normal flowers are pink. The flower…
A: Detailed explanation:In this complementation test, eight different mutant strains of flowers, each…
Q: What is a synchondroses joint? what kind of connective tissue it contains and what functional…
A: Synchondroses Joint (Cartilaginous Joint Type)- **Structure**: A synchondroses joint is formed where…
Q: a tablet is required to contain 250 mg of active ingredient. Express this requirement in terms of a…
A: The question is asking us to express the requirement of 250 mg of active ingredient in a tablet in…
Q: Medical coding and payers assignment what three examples of wrong billing that could affect the…
A: 1. Incorrect Coding (CPT/ICD-10/HCPCS Codes)Example: Using the wrong Current Procedural Terminology…
Q: Don't use Ai
A: The correct answer is Identification. The change in media color on an MSA (Mannitol Salt Agar) plate…
Q: In the community Las Vegas, NV or Clark County Health Assessment (CHA) and Community Health…
A: Reference:https://www.astho.org/topic/brief/addressing-hypertension-in-pregnancy-to-reduce-maternal-…
Q: Graded potentials in neurons: Question 5 options: a. Graded potentials that…
A: a) is correct: Because chloride ions are negatively charged and hence raise the negativity inside…
Q: an example of a chemical carcinogen in pesticides
A: A carcinogen is any substance, radionuclide, or radiation that promotes carcinogenesis, the…
Q: Add a File ewContent/3261576/View Metabolism and Energy (14 marks) Question 3 (5 points) Use the…
A: To explain the energy changes in a chemical reaction as represented by the graph, you can follow…
Q: Why should LTBI cases complete TB treatment? Select all that apply. Group of answer choices None of…
A: LTBI stands for Latent Tuberculosis Infection. It is a state where a person is infected with…
Q: Do not use Ai
A: Specialized for collecting, processing, and distributing electrical signals across the body, nervous…
Q: This week you were introduced to two different and distinct ethical frameworks which are the…
A: Let's apply the ethical frameworks to your public health interventions directly: Initial Post:…
Q: a) Draw a lily pollen grain in anaphase of meiosis II. How many gametes (sperm) will be in the…
A: Let's break down each part of your question:a) Drawing a Lily Pollen Grain in Anaphase of Meiosis II…
Q: Explain how oxidation and reduction reactions are utilized in energy flow in cells- both in terms of…
A: Solution:Redox reactions that comprises both of oxidation as well as reduction reactions play a…
Q: Short Question:-2 Course Code: BIO121 Course Name: Principles of Biology I (a) Plasma membrane is…
A: The plasma membrane, also known as the cell membrane, is said to be selectively permeable because it…
Q: Draw , label adiagram of ligustrum leaf (internal)and describe it's structures and adaptation
A: Solution:Structures of the Ligustrum Leaf:Cuticle: Thin, waxy, impermeable layer lying over both the…
Q: draw a simplified model of the process of meiosis and an accompanying list of key terms, use this…
A: Detailed explanation: Simplified Model of MeiosisMeiosis I:Homologous Chromosomes: Pairs of…
Q: A cell contains 100 mM K+ and is surrounded by interstitial fluid containing 10 mM K+. The…
A: Understanding the Nernst Equation and Its Application to Cellular PhysiologyIntroductionThe Nernst…
Q: This climate diagram depicts which biome? [mm] 100 50 40- 30- 20- 10- 0- 80 00 g -60 40 20 20 0 -10…
A: Answer well explained above
Q: (a) What is Figure 1 in the Zheng et al paper showing? Describe it in your own words. (b) What are…
A: Without the actual paper and Figure 1, it's impossible to describe it accurately. However, based on…
Q: 16.27 Predict the major product from each of the following reactions. (a) H CHÍNH), cat. HA (b)…
A:
Q: 00:54 TET. 4. 49% NW NSC LFSC P1...NG SEPT 2024.pdf - Read-only K the investigation. The diagram…
A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…
Q: 1). Delilah has normal feet and married Jack, who never ever (ever) took his surf shoes off. Before…
A: 1) Autosomal Recessive Inheritance:In autosomal recessive inheritance, an individual must inherit…
Q: the transfer of genetic material during bacterial conjugation requires? a. flagella b. sex pili c.…
A: Bacterial conjugation is a process of genetic material exchange between two bacterial cells. It is…
Q: Choose a type of bias that was not one of the three main types of bias discussed in the video…
A: One type of bias that is distinct from sampling bias, measurement bias, and confirmation bias is…
Q: Don't upload image. Answer in step by step with explanation. Don't use Ai and chatgpt
A: Step 1. Relative Water Level: 45 Explanation: At this level, the mouse population cannot sustain…
Q: All of the bove, and Vertebrae are incorrect answers. I need help
A: Important information: SynapomorphyRefers to a trait or characteristic that is shared by two or more…
Q: Stream 2 + Taxon # individuals (n) n-1 n(n-1) 1 2 23456700 S 5 4 8 2 3 8 4 9 10 119 11 2 12 3 ΣΝ…
A: Green - Given Yellow - Sum of all n; Just add all n Violet - n-1; Subtract 1 from the 2nd column…
Q: Choose the best answer. Fossils found further down in a layer of rock are most likely Select an…
A: The correct answer is b more ancient.Fossils found further down in a layer of rock are typically…
Q: Discuss, in general terms, how a cell receives and processes information that lets it know what it…
A: The signal transduction process is a fundamental mechanism that allows cells to sense and respond to…
Q: Hello, Can you please help me with the next question? (I would aprecciate a short answer). If you…
A: Detailed explanation: Rabies is a viral infection that affects the central nervous system and is…
Q: In your own word write on cellular respiration more than one paragand Discuss differences with…
A: The conversion of the chemical energy that is stored in glucose into a form of energy that can be…
Q: What is a good response to? For my review of the El Paso Community Health Needs Assessment (CHA)…
A: References: Centers for Disease Control and Prevention. (2020). Overweight & Obesity. Retrieved…
Q: Question 5 (Mandatory) (2 points) ✓ Saved Why is prey productivity always more than predator…
A: The correct answer is C) Because energy is lost at each trophic level due to basic maintenance costs…
Q: On the molecule below, highlight all R stereocenters in red and all S stereocenters in blue. If it…
A:
Q: Hello, Can you please explain to me how to treat an infection with this organism "Toxoplasmosis" and…
A: 1. Treating Toxoplasmosis InfectionAs a future healthcare provider, I understand that treating…
Q: What type of graph would you use to show how the price of gas changes over a year? bar graph…
A: Question 7: Graph to Show Price Changes Over a Year Correct Answer: Line graph.Explanation:Line…
Q: The genotype of F1 individuals in a tetra hybrid cross is AaBbDdEe. Assuming independent assortment,…
A: The genotype of the F1 individuals is given as AaBbDdEe. This means that for each trait, the…
Q: 12. The diagram shows a male reproductive system. Name the parts labeled A, B, and C and give one…
A: Question 12:a) Name the parts labeled A, B, and C, and give one function for each.A: Vas deferens -…
Q: What region of the body is the vertebral column found in?Is this dorsal or ventral?What major organs…
A: The vertebral column, also known as the spine, plays a critical role in the human body. It is…
Q: Which of the following molecules is the most hydrophobic? Group of answer choices Leucine Stearic…
A: Hydrophobicity refers to the property of a substance to repel water. In the context of molecules,…
Q: Hello. Do you know what bacteria is the one in the next video?…
A: Refer to the solution
Q: Do not use Ai
A: Rules for finding the complementary RNA molecule given a DNA sequence:Convert the A's into…
Q: You're learning about diffusion and osmosis, because they are central to the biology of cells and…
A: Refer to the solution
Q: Hello, Can you please help me with the next question? (I would apreciate a short answer). What is…
A: Approach to solving the question:Researched through Books and online resources/ reference with…
Q: Course Code: BIO-121 Chapter 3: Molecules of Life Course Name: Principles Of Biology-1 3. (i) Name…
A: A nucleotide, the basic building block of nucleic acids (DNA and RNA), is composed of three…
Q: 4.Would the Biuret reagent give a positive reaction with the monomers amino acids? Why or why not?
A: If Biuret's reagent is put to a solution with solely amino acids then it will stay blue and give a…
Q: Sort the properties to describe each of the three domains. Some of the properties may be used more…
A: The three domains of life are Archaea, Bacteria, and Eukarya. These domains are a part of the…
Q: * 17. When a Chinese hamster with white spots is crossed with another hamster that has no spots,…
A: Detailed Further ExplanationThe scenario described suggests a classic case of Mendelian inheritance…
Step by step
Solved in 2 steps
- 41 The initiation complex for translation includes transfer RNA-MET. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. TRUE FALSEWith this gene provided: MuPKS c.1949 C>T (p.R644W) Please provide the following; 1. Name of the gene 2. Location of the nucleotide change 3. Nucleotides that are changed 4. Type of mutation 5. Amino acid change 6. Location of the amino acid change8:42 ul 5Gº 0 Chapter 9 DNA worksheet 2022.d... CCG Pro CAG Gln ACU ThrAAU Asn ACC Thr AAC Asn ACA ThrAAA Lys CUG Leu AAUU Ile AUC Ile AUA Ile AUG Met START ACG ThrAAG Lys GGUU Val GUC Val GUA Val GUG Val G AGU Ser IC CGG Arg AGC Ser AGA Arg A AGG Arg GCU Ala GAU Asp GCC Ala GAC Asp GGC Gly GCA Ala GAA Glu GCG Ala GAG Glu GGG Gly GGU Gly C A U GGA Gly G 4. A set of DNA has been given that is 40% T bases. W percentages of the other bases in this sequence A,C, and 5. (2 points) A. What organelle is responsible for Translation? B. Where is the organelle from part A located in Euk 6. What are the three types of RNA and what are their fu during protein production? Dashboard Calendar To Do Notifications Inbox 因
- Is it possible to have a mutation in nucleotide four that would produce the same amino acid? If yes provide an example.1> E %# m 12 Search entral dogma (1) - Word Review View Help b 13 ^、,三,出令 1 Normal 1 No Spac. Heading 1 AaBbCcI AaBbCcI AaBbC AABBCCD AaB AaBbCcD Heading 2 Title Subtitle A Sel 4. Paragraph Styles Editin 5. 7. 3. 9. The following sequence is a wild-type bacterial gene that encodes a short protein. The sequence given is from the point where transcription starts (called "+1") to the point where transcription ends. Transcription goes left to right. 5'-ACTTCGATATGTCTAAAATATCGATCGATCTGTGGGGCCTAGCTAGCTAACCAGAGACGCTACCG-3 3'-TGAAGCTATACAGATTTTATAGCTAGCTAGACACCCCGGATCGATCGATTGGTCTCTGCGATGGC-5' (a) Which strand (the upper or the lower) is used as the template in transcription? (b) Write out the first 20 bases of the RNA transcribed from this wild-type gene. Make sure to label the 5' and 3' ends of your molecule. (c) Write out the amino acid sequence of any protein that is encoded by this wild-type gene. Make sure to label the N and C termini of your molecule. The following sequence is a mutant…Explain the connection between the founder and the G8-C marker.
- + Jimenez me O Lab Interac O (71) Alfie Ca G lab concord G quantum m b Success Cor a holodeck * Regression * Page missir G regression O Lab Inte x Ask Your ST + Lab Interac A Not secure | http://lab.concord.org/embeddable.html#interactives/sam/DNA-to-proteins/4-mutations.json Share About DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG Edited sequence Apply Show DNA Transcribe Translate Show protein Continue one step Start/continue model Stop Reset The Concord Consortium 9:45 pm 12/05/2022 30°C ENG 4) O Partly cloudy US (7.(See here for APA formatting https://docs.google.com/document/d/10e2EI-fEXHVfj7GbKaJj9roxzRgAqN6BaK2HDBjRJvk/editDoes this statement is a example of a phenocopy? Explain your reasoning. Q. Phenylketonuria results from a recessive mutation that causes light skinas well as intellectual disability.
- Complete each of the following events in their proper order. In the first event you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN. When your protein is completed, the final event is to match your protein with it's proper trait.GAG Glu GGG Use the genetic decoder provided to assist in answering this question.\ Second letter UGUT UGC Cys Stop UUU UTo UCU UAU Tyr ULIC Phe UACJ Ser UCC UAA Stop UGA A UAG Stop UGG Trp G UUA nan onn UCG OLeu UCA CAU CGU) CACHS Pro CAA CUU CCU His C CUC Leu C CUA LEUCCA ) Gin CAGJ CGA Arg CUG CGG ACU AAULAso AGUser AUU AUC le AUA AUG Met ACG ACC ACA The AAA AGA AAGJ AGG JArg 6 FLys GAUAn GU GUU GUC GCU GCC Asp Val GUA GAC Ala GAA Glu GAG GGC A Gly GGA GGG GCAA GUG GCG What do you predict would happen if you created a tRNA with an anticodon of 5'-AGG-3' that is charged with methionine, and added this modified tRNA to a cell-free translation system that has all the normal components required for translating RNAS? We did one like this in class... we have to think'about the directionality (5' -> 3' or 3' -> 5'). The easiest way is to draw out your anticodon and codon first, and then consider are the strands going to line up parallel or anti-parallel. O a. methionine would be…Е. F. С. D. A. B. COMPLEMENTARY BASE PAIRING 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus X174: ATG T GT CA AAGACGGT Dayonna Rucker C C T G T T T T G T A CCGTCAGGATTGA G T T T T C A T G C CТССАААТСТТ
