Answered: Which of the following molecules will…

Which of the following molecules will not dissolve in water?a. Non-polar Lipophilic moleculesb. Glucosec. Polar Hydrophilic moleculesd. Electrolytese. None of the above is correct

Ebk:Nutrition & Diet Therapy

10th Edition

ISBN:9780357391747

Author:DEBRUYNE

Publisher:DEBRUYNE

Chapter9: Water And The Minerals

Section: Chapter Questions

Problem 2SC

See similar textbooks

Related questions

Q: A. Describe the steps in a PCR reaction in detail B. Describe what it means that DNA replication is…

A: D. Prokaryotic Replication Fork DiagramHere is a diagram of the prokaryotic replication fork. It…

Q: Which is not a characteristic of phylum annelida: closed circulatory system, segmentation,…

A: The phylum Annelida is a large group of segmented worms, including earthworms, leeches, and their…

Q: Outline the path of blood flow through the heart by listing the name (and associated number) of each…

A: Here is a detailed description of the role each structure plays in the path of blood flow through…

Q: Use an example to illustrate how two different species concepts can lead to different species…

A: Solution:An example of how two species concepts can lead to different determinations is the case of…

Q: Hello, Can you please help me to explain What are some of the symptoms of the flu? What are some of…

A: Approach to Solving the Question:To provide a detailed answer about flu symptoms and complications,…

Q: How are the effects of the nitrates different from the effects of inhaled solvent fumes?

A: Nitrates are chemicals that are commonly found in fertilizers, food preservatives, and even in some…

Q: Determine wheter a probiotic pill protects against food-borne illnesses,how would you develop a…

A: Developing a Hypothetical Observational Prospective Cohort Study: Probiotic Pills and Protection…

Q: If a person is on both clopdifogrela and omperzaole, which are they more likely to experience,…

A: When considering the interaction of clopidogrel and omeprazole, it's important to understand how…

Q: a) Describe the discovery of polymerase chain reaction (PCR), the components of the reaction and the…

A: The polymerase chain reaction (PCR) is a cornerstone of molecular biology, enabling the…

Q: Imagine that you are walking through the desert and you get scratched by a thorn on a mezquite,…

A: The innate immune system reacts first when bacteria X enters through the thorn: dendritic cells…

Q: Below are 7 coenzymes, each shown as complete structures. Write the name or abbreviation of each…

A: 1.NAD+ (Nicotinamide Adenine Dinucleotide)Structure: NAD+ consists of two nucleotides joined by a…

Q: What is the role of thermodynamics in microbial metabolism in Gibbs free energy and its importance…

A: Thermodynamics is a branch of physics that deals with the relationships between heat and other forms…

Q: Question 6 (Mandatory) (5 points) 1. fough Number of Individuals b Time Benthic macroinvertebrate…

A: Graph Stages:a: The population is starting from a very low point and growing rapidly.b: The…

Q: Please label the diagram

A: The given diagram is an animal cell: 1. Cell Membrane 2. Nucleus 3. Rough Endoplasmic reticulum 4.…

Q: an example of a chemical carcinogen in pesticides

A: A carcinogen is any substance, radionuclide, or radiation that promotes carcinogenesis, the…

Q: Henrietta Lacks's cells have easily been the most important human cell line used in research in the…

A: Biomedical Ethics and the Role of ResearchersBiomedical ethics is the cornerstone of ethical…

Q: Don't use Ai and chatgpt. Answer in step by step with explanation.

A: Bayesian approach is a statistical technique grounded in probability theory with objective of biase…

Q: You are working in a lab that synthesizes metabolic inhibitors, you are asked to explain your two…

A: Approach to solving the question: Detailed explanation:Here are two potential explanations,…

Q: improvement in food resources notes

A: Improvements in Food Resources 1. Agricultural InnovationsGenetic Engineering: Development of…

Q: Biology Questions The questions are showed in the attached pictures

A: Assignment 3: RNAWrite the term that matches each meaning:d. Riboseb. Onec. Uracild. DNA Assignment…

Q: Can you fill out the second paper based on the first paper? Please provide steps for at least one of…

A: Here's a detailed explanation and step-by-step guide on how to fill out your frameshift mutation…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt.

A: Common Structure: A single-pass transmembrane protein is typically composed of three domains:…

Q: You will use the following scenario to answer a group of 5 questions. You have isolated a microbe…

A: Solution:The correct sequence in order is: Genomic DNA Extraction → Amplification of Targeted Gene →…

Q: Solve the problem clearly and thoroughly, using the image for all relevant information. Once done,…

A: Step 1 a). The restriction enzymes with specific sites in the plasmid include Eco RI, Bam HI, Hind…

Q: What is the overall treatment for pulmonary fibrosis?

A: Pulmonary fibrosis is a lung disease that occurs when lung tissue becomes damaged and scarred. This…

Q: 4-Hello, Can you please help me with the next question? How would an understanding of Enterobius…

A: Note: Hello, student. I sincerely hope I was able to answer your question, you are free to edit…

Q: A cross in Drosophila melanogaster involved the recessive X-linked genes for white eye (w), yellow…

A: Answer well explained above

Q: Hello, Can you please help me with the next question? How does the rabies virus enter the body and…

A: Rabies is primarily transmitted through the bites of infected animals, including dogs and bats. The…

Q: Provide the following measures: incidence rate, cause-specific rate, age-specific death rate, and…

A: The incidence rate is a measure of the risk of developing some new condition within a specified…

Q: could you help me explain the steps to solving this problem?

A: To solve this problem and create a restriction enzyme map based on partial BamHI digests, follow…

Q: Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following…

A: Answer:DNA Template Strand: 3' TACGCTGATCCAAACGGCCTACCTAC 5'mRNA: 5'…

Q: • Is this anabolism or catabolism? • Can you describe the movement of electrons? plasma membrane…

A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…

Q: how would you explain to your neighbor why his fish are dying? Use concepts and evidence from lab to…

A: Refer to the solution

Q: Does this article pass the CRAPP test? How so? Substance Use Disorder Treatment and Family Therapy:…

A: The CRAPP test is a simple tool used to evaluate the quality and reliability of information sources.…

Q: Biology Questions The questions are showed in the attached pictures.

A: Here are the terms that match each phrase: Step 1. Molecule containing genetic information a. DNA…

Q: a) What is the difference between blunt ends and sticky ends and which one is useful for vector…

A: Sticky ends generated by restriction enzymes that cut DNA at offset positions in the different…

Q: 7 HYB (0x Mail - Venner, Alyssa × Careers With Indian H x Medical Assistant Pre × New Tab X…

A: Meiosis is a type of cell division that results in four daughter cells each with half the number of…

Q: Are advocacies against the products of modern biotechnology actually help safeguard the welfare of…

A: The primary goals of the movement against contemporary biotechnology in agriculture are social…

Q: Briefly describe why pacemaker cells are able to depolarize in the absence of a stimulus.

A: References:https://www.ncbi.nlm.nih.gov/books/NBK537194/https://www.ncbi.nlm.nih.gov/books/NBK459238…

Q: What are keratinocytes and what do they do? 2. Which layer(s) of epidermis do I find melanocytes…

A: 1. What are Keratinocytes and What Do They Do? Keratinocytes are the predominant cell type found in…

Q: Table 6-3. Group F, results. PHENOTYPE OF F2 PROGENY Light brown, Red, Normal YOUR DATA PARTNER #1…

A: Step 1: Understanding the DataThe table is labeled "Group F₂ results," indicating this data pertains…

Q: Hello, Can you please help me to develope the "Toxic shock syndrome" please? (I would apreciate no…

A: A Comprehensive Review of Toxic Shock Syndrome (TSS): Pathophysiology, Treatment, and Prevention…

Q: Biology Questions The questions are showed in the attached pictures.

A: Step 1). 1. Aorta: The largest artery, originating from the left ventricle, distributing oxygenated…

Q: 5. Now assume that homozygous recessive individuals never survive. You observe that over the next 5…

A: Let's understand the Chi-square formula before filling the table:χ2 = ∑ ((o - e)2/ e)Where:o :…

Q: Which of the drugs below cause CNS side effects a. Antibiotics b. Platelet-inhibiting drugs c.…

A: The question is asking us to identify which of the given drugs can cause side effects related to the…

Q: One of the gram negative bacilli we looked at in lab was Salmonella. Discuss two ways that…

A: Salmonella is a type of bacteria that can cause foodborne illness, known as salmonellosis. It is a…

Q: The arrows in the diagram below show how energy and matter flow between organisms. M

A: The diagram shows the flow of energy and matter between producers and consumers in an…

Q: The genotype of F1 individuals in a tetra hybrid cross is AaBbDdEe. Assuming independent assortment,…

A: The genotype of the F1 individuals is given as AaBbDdEe. This means that for each trait, the…

Q: Phenotype Observed Proportion + 368 0.3545 AR 670 0.6455 Total 1038 1.0000

A: The data you provided suggests that there are two phenotypes, AR and Total. The observed proportion…

Q: Biology Question

A: It looks like you've uploaded an ECG image. To provide a meaningful analysis or answer a question…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

Which of the following molecules will not dissolve in water?
a. Non-polar Lipophilic molecules
b. Glucose
c. Polar Hydrophilic molecules
d. Electrolytes
e. None of the above is correct

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Adding HCO3 to a solution will cause the concentration of H* to - and the pH to. Select one: O a. increase; increase O b. increase; decrease O c. decrease; increase O d. decrease; decrease O e. HCO3 has no effect on H* concentration
A fish swims into cold water. How should it regulate so that the cell membrane continues to have the same fluidity as usual? (more than one answer may be correct) which are correct a.increase the length of lipids with short hydrocarbon tails b.increase the number of steroids in the cell membrane c.more saturated lipids in the membrane d.reduce the proportion of lipids with short hydrocarbon tails e.more unsaturated lipids in the cell membrane
two of these statements are truths and one is a lie. Which of the following statements is a lie? a. The concept of pH is exclusive of how buffers work. b. Salts dissociate into ions (except H+ and OH-) when dissolved in water. c. ATP stores a large amount of potential energy.
Match the following descriptions with the correct lipid-based compounds:
Essential oils are fat soluble and attracted to lipids and are, therefore, considered: Choose one answer. a. oleophobic b. hydrophilic c. lipophilic d. amphiphilic
Based on the pH of your drug, if your drug was in a high concentration in the blood,how would it affect the pH of your blood. Would it cause acidosis or alkalosis, and how would you treat this? drug Lipitor ph is 7 it's acidosis?
Which of the following statements best explains the insolubility of lipids in water? a. The structure of lipids includes hydrophilic molecules. b. The polar portion of lipids is much larger than the nonpolar portion. c. The polar portion of lipids is much smaller than the nonpolar portion. d. The polar and nonpolar portions of lipids are of the same size.
Define the following terms: a. solvation sphere b. amphipathic c. micelle d. hydrophobic effect e. clathrate
Match the following descriptions with the correct lipid-based compounds: Cholesterol Sphingolipids Phosphoacylgycerol Glycerophospholipids Fatty acyls…
Which of the following statements concerning palmitic acid is INCORRECT? a. It can barely be dissolved in water. b. It is an unsaturated fatty acid. c. It is consisted of 16 carbons. d. It is a lipid.
Which of the following molecules is amphipathic? Select all that apply. Select all that apply A triglyceride B phosphate C phospholipid D glucose E fatty acid F cholesterol Submit
Glucose dissolves in the water of blood plasma. This mixture is best known as a(n): a. solution. b. suspension. c. aerosol. d. colloid.