1. Based on the partial BamHI digests shown on the gel below, draw a restriction enzyme map for the linear DNA fragment. 6 5 4 3 2 1 Time | | |
Q: Drawing need only for cellulose part clean handwriting Darwing or computerize okkk only 100% sure…
A: I have draw the structure in the table above. The computerized drawing can be drawn as;
Q: 00:54 TET. 4. 49% NW NSC LFSC P1...NG SEPT 2024.pdf - Read-only K the investigation. The diagram…
A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…
Q: #24
A: The question asks us to determine which of the listed blood types could not be that of the child's…
Q: None
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: Identify one flaw in your friend's experimental design other than extraneous variables and suggest a…
A: Identifying the Issue: Absence of RandomizationIn experimental research, randomization is essential…
Q: improvement in food resources notes
A: Improvements in Food Resources 1. Agricultural InnovationsGenetic Engineering: Development of…
Q: The patient’s tumor will likely require tumor resection with partial ostectomy (give definition:…
A: Here is the revised sentence: Here is the revised sentence: Patient's tumor will likely be is to…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt
A: The H gene controls the presence of the ABH antigen in the red blood cell and it codes for…
Q: 7.1 Is There a Trade-Off between Current and Delayed Reproduction in the Collared Flycatcher?…
A: QUESTION 1. Question 3Do the results indicate that allocating resources to current reproduction…
Q: In pea plants, purple flowers (P) are dominant to white flowers (p) and yellow peas (Y) are dominant…
A: First, we need to determine the possible gametes that each parent can produce. A gamete is a sex…
Q: If given this kind of table, how do I calculate the frequency of the A allele and B allele…
A: Detailed explanation:Allele frequency = (Number of alleles of that type) / (Total number of alleles)…
Q: Explain the signaling cascade system in breast cancer by hereditary factor BRAC1, BRAC2 and hormonal…
A: Refer to the solution
Q: Which statement about CD8 T cells and their activity is true? 1. They are easier to activate than…
A: The correct answer is 3. Cross presentation is often required for their activation, but is not…
Q: In the following image, A and B are and chromosomes Chromatids Centromere O O O O O A B Replication…
A: Approach to solving the question:To Determine Replication: Look for the presence of sister…
Q: What are some possible ways that humans could mitigate the effects of cnidarians?
A: Cnidarians, which include species like jellyfish, corals, and sea anemones, can pose various…
Q: page write up of a chapter or two in the Bible related to Plant Science. Write the entire Bible…
A: I hope you learned something. If you have any questions, clarifications and need more information…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: Step 1: Set Up the Genotypes Fly #1: bbEe.Fly #2: Bbee. Step 2: Identify Possible Gametes for Each…
Q: Do not use Ai
A: The question is to predict the phenotypic ratio of the offspring by cross breeding two double…
Q: What do enzymes 1,2,3, and 4 represent
A: Enzymes 1, 2, 3, and 4: A Metabolic PathwayWithout additional context, it's difficult to…
Q: MATCH THE FOLLOWING TERMS TO THE BLANKS IN THE FOLLOWING PASSAGE: A group of tourists become…
A: Here are the answers to the blanks in the passage:1. a. Genetic drift2. b. mutation3. c. gene flow4.…
Q: What is a good response to? For my review of the El Paso Community Health Needs Assessment (CHA)…
A: References: Centers for Disease Control and Prevention. (2020). Overweight & Obesity. Retrieved…
Q: The action of the bronchodilator aims at opening blocked or closed airways. This helps the patient…
A: A) Restoring blood flow to those alveoli:Incorrect. The primary action of bronchodilators is to…
Q: Snyder test results interpretation
A: The Snyder test is used to evaluate a patient's metabolic state by measuring the levels of certain…
Q: Question 2 You have read in the literature that the risk of death from stroke differs between males…
A:
Q: Answer in step by step with explanation. Don't use Ai and chatgpt.
A: Step 1: Step 2: Step 3: Step 4:
Q: If an mRNA sequence begins 5'-GGACGUAGA...-3', which of the following sequences would continue that…
A: Hairpin loop is formed when the two mRNA strands have complementary sequences at their ends that's…
Q: Refer back to the information about R-E-C tables from your pre-lab activity to answer Question 1. A…
A: First, identify the information that reinforces your previous knowledge. This is the information…
Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.
A: The answer is B. Inhibition of CDK2.Myc is a proto-oncogene that plays a central role in regulating…
Q: None
A: Osmosis:Osmosis is the movement of water molecules through a selectively permeable membrane from an…
Q: 3. Some basic advice about graphing. a. Always use graph paper and a ruler. b. It is very important…
A: 1. Table 1.4: Average Monthly Temperatures (°F) at Central Park in 1919 and 2019 - Independent…
Q: 11) What happens to the field of view with respect to magnification? a.) As magnification…
A: Step 1:Step 2:Step 3:Step 4:
Q: Hello, Can you please help me to describe the major characteristics of "Hodgkin’s lymphoma" (or…
A: Detailed explanation:Hodgkin's lymphoma, also called Hodgkin's disease, is one of the more common…
Q: Assuming normal resting membrane potential of a cell, if potassium were to leak down its…
A: 1. Resting Membrane Potential: The resting membrane potential of a typical neuron is around -70 mV.…
Q: A patient develops sudden breathing problems after recently increasing his workouts. He presents…
A: The Hemoglobin-Oxygen dissociation curve illustrates the relationship between the partial pressure…
Q: Biology Question
A: Explanation of this ECG strip 1. Rhythm and Rate: The rhythm appears regular, with consistent…
Q: Which is not a characteristic of phylum annelida: closed circulatory system, segmentation,…
A: The phylum Annelida is a large group of segmented worms, including earthworms, leeches, and their…
Q: Question 3 (Mandatory) (6 points) You observe a newly-abandoned farm field. Make a prediction of how…
A: A comprehensive response, complete with appropriate explanations and reasoning has been provided in…
Q: and please explain the “initiation” event of “(?)”, transcription, and translation.
A: DNA Replication Initiation:Begins at specific sequences called origins of replicationHelicase enzyme…
Q: The postdoc in the lab gives you two samples: one is the Gram-positive B. anthracis and the other…
A: Membranes of bacteria and archaea are diverse from one another in important structural…
Q: Biology Question
A: It looks like you've uploaded an ECG image. To provide a meaningful analysis or answer a question…
Q: 1,What are the two main purposes of mitosis? 2,Why would we expect larger animals with longer…
A: Mitosis is a process of cell division that results in two genetically identical daughter cells…
Q: what is happening in TELOPHASE I? Include Crossing Over and Independent Assortment when they occur.
A: In Telophase I, the first phase of meiosis, the chromosomes reach the opposite poles of the cell.…
Q: At the "bl" locus (=gene), the wild phenotype has a light colored body, while the mutant has a dark…
A: In a dihybrid cross, we are examining the inheritance of two different traits simultaneously. In…
Q: Explain how oxidation and reduction reactions are utilized in energy flow in cells- both in terms of…
A: Solution:Redox reactions that comprises both of oxidation as well as reduction reactions play a…
Q: Review article abstract and abstract generated by Chat GPT and identify three issues present in the…
A: Reference:https://pubmed.ncbi.nlm.nih.gov/25211222/
Q: The adaptive value is a measure of the evolutionary impacts of a behaviour, i.e. the ultimate…
A: The behaviour of a horse gently swishing its tail and occasionally stomping its feet is a response…
Q: 2. Describe what would happen to a plant cell and an animal cell if they were placed in the…
A: a) Hypertonic Solution:Plant Cell: In a hypertonic solution, the concentration of solutes is higher…
Q: consider a muscle cell is changing from relaxation to contraction 1)Is the length of the…
A: Understanding SarcomeresStructure of SarcomeresSarcomeres are the smallest functional units of…
Q: As compared to eukaryotic cells, only bacterial cells have ___. A) ribosomes B) photosynthetic…
A: A) RibosomesBacteria: Ribosomes are present in bacterial cells where they are responsible for…
Q: Don't use Ai
A: Key references: NCI Dictionary of Cancer Terms. (n.d.). Cancer.gov.…
could you help me explain the steps to solving this problem?
Step by step
Solved in 2 steps
- Please explain in detail....The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.
- i1) What happened to the DNA at the different temperatures? How does Polymerase Chain Reaction exploit this property of DNA (Word count: 200) 2) Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company that supplies regents and kits for DNA extraction (e.g Qiagen, ThermoFischer, Invitrogen, or similar). Please Include the weblink for the published protocol you used as a referenceAfter restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA
- Please in detail, what the picture attached representsGiven the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
- a) Calculating Transformation Efficiency For the +DNA/+Amp/+IPTG plate, record the following: Number of transformants (colonies): _________________ Nanograms of plasmid DNA added: 50 ng Final recovery volume: 0.50 mL Volume plated: 0.25 mL Transformation efficiency equation: Transformation efficiency = Number of transformants / µg of DNA x Final volume at recovery (mL)/ volume plated (mL) b) Using the equation above, calculate the transformation efficiency. c) Describe the success of the transformation efficiency of this demo based on the calculation you did above?31.) The following DNA fragment was sequenced by the Sanger method. The asterisk indicates a fluorescent label. *5'------3'-0H 3'------ATTACGCAAGGACATTAGAC---5' A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in an appropriate buffer) listed below. Dideoxynucleotides (ddNTPs) were added in relatively small amounts. Lane 1: DATP, dTTP, dCTP, dGTP, ddTTP Lane 2: DATP, dTTP, dCTP, dGTP, ddCTP Lane 3: DATP, DTTP, dCTP, dGTP, ddATP Lane 4: DATP, dTTP, DCTP, dGTP, ddGTP The resulting DNA was separated by electrophoresis on an agarose gel, and the fluorescent bands on the gel were located. The band pattern resulting from nucleotide mixture 1 is shown below. Assuming that all mixtures were run on the same gel, what did the remaining lanes on the gel look like? ( Fill in the gel below.) 3 Electrophoresis Il||5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
