BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 10, Problem 4CT
The photos below show flowers from two Arabidopsis plants. One plant is wild-type (unmutated); the other carries a mutation in one of its ABC floral identity genes. This mutation causes sepals and petals to form instead of stamens and carpels. Refer to Figure 10.7 to decide which gene (A, B, or C) has been inactivated by the mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You conduct an experiment to study the expression of the S protein through the
tissues of your favorite plant (Arabidopsis thaliana). The morning of the experiment
you inject in the leaves a messenger RNA that codes for the synthesis of a single
protein made of two parts that are attached to each other: the functional S protein
and a red fluorescent protein tag (RFP). You perform two cross sections of the same
root, one section at the start of the experiment (time = Oh; corresponding to the time
of injection) and one section in the afternoon (time = 8h). Through fluorescent
microscopy you observe a change in the coloration inside the cells of the root's
central tissues (as indicated by the arrows): from no coloration (time = Oh) to red
(time = 8h).
• The cells of the central tissues in the roots do not have nuclei or ribosomes.
How can you explain this change of coloration? Please provide a cellular
feature that can lead to this.
• What is one advantage of using an RFP-tag in an mRNA?…
You are a developmental geneticist studying flowering time variation in Arabidopsis. You perform a
mutagenesis screen to identify mutants in the photoperiod pathway. You conduct the screen and
find two different plants that show the same mutant phenotype. You then use a complementation
test. What is the predicted outcome of this test if both phenotypes are caused by mutations in
separate genes?
recover the wild type phenotype
overexpress the gene
O recover the mutant phenotype
Which gene encodes the enzyme at the upper boxed step in the pathway?
Which gene encodes the enzyme at the upper boxed step in the pathway?
gene 1
gene 2
gene 3
gene 4
Chapter 10 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 10 - Gene expression does not vary by ________. a. cell...Ch. 10 - Binding of _______ to _______ in DNA can increase...Ch. 10 - Prob. 3SACh. 10 - Mechanisms that govern gene expression do not...Ch. 10 - Muscle cells differ from bone cells because they...Ch. 10 - Prob. 6SACh. 10 - Prob. 7SACh. 10 - Prob. 8SACh. 10 - Which of the following includes all of the others?...Ch. 10 - Prob. 10SA
Ch. 10 - Prob. 11SACh. 10 - Prob. 12SACh. 10 - Prob. 13SACh. 10 - True or false? Gene expression patterns can be...Ch. 10 - Match the terms with the most suitable...Ch. 10 - Why are some genes expressed and some not?Ch. 10 - Do the same mechanism of governing gene expression...Ch. 10 - Prob. 3CTCh. 10 - The photos below show flowers from two Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the module, you have learned about P-element mediated transgenesis in Drosophila and the concept of using transgenes to rescue mutant phenotypes. In the figure below, you will see a wild type fly with its natural eye colour and three mutants with their eye colours changed to vermillion, white and rosy, respectively. A schematic of P-element mediated transgenesis (as shown in the lectures) is also included in the figure. Please inspect the schematic carefully and choose which of the following statements is true: I. Injection of the white experimental transgene into the vermillion mutant embryo will not change the vermillion mutant phenotype II. Injection of the white experimental transgene in the rosy mutant embryo will change rosy eye colour to red (wild type) III. Injection of the white experimental transgene in the white mutant embryo will not change the white mutant phenotype IV. Injection of the white experimental transgene in the rosy mutant…arrow_forwardTrace the genetic steps in the development of a peanut plant that isresistant to insect larvae (table given). (Hint: You need to useAgrobacterium.)arrow_forwardSchizosaccharomyces pombe, also known as "fission yeast," is a powerful model organism in molecular and cell biology. While performing a genetic screen, you discover an auxotrophic S. pombe strain that is unable to synthesize one or more vitamins. The following table represents the key experiments you performed during your genetic screen. Fill in the table with the outcome of each experiment for your mutant strain (using + for growth and - for no growth). Medium Rich media Minimal media Minimal media + all vitamins Minimal media + all amino acids Growth Wild-type + + + + Mutant + + + > > >arrow_forward
- What is the correct answer, and why?arrow_forwardThe sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) - 42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mutl Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAarrow_forwardThe genes described below are part of the yeast mating signal transduction pathway that signals the presence of extracellular alpha pheromone to the nucleus. These genes are listed in the order they function in the pathway. STE3 encodes alpha pheromone receptor STE4 encodes the ß subunit of a heterotrimeric G protein STE7 encodes a protein kinase STE12 encodes a transcription factor Loss-of function-mutations in any of these genes are sterile. In addition, gain-of-function mutations can be isolated in these genes. For which gene would a loss of function mutation suppress gain-of-function mutations in any of the other three genes. STE3 STE7 STE12 STE4arrow_forward
- Three haploid fungal mutants that require compound W for growth were isolated. Each mutant contains a recessive allele in a single gene. Three compounds (A, B and C) in the biosynthetic pathway to W are known, but their order in the pathway is unknown. Each compound is tested for its ability to support the growth of each of the three mutants. Phenotypes of all of the three mutants are shown in the following table (“+" indicates growth, "-" indicates no growth). A C W Mutant 1 Mutant 2 Mutant 3 What would be the phenotype of a haploid mutant that contains both mutant alleles in mutant 2 and 3? Phenotype refers to growth or absence of growth on compounds A, B, C and WN. O Like mutant 1 O Like mutant 2 Like mutant 3 O Like wild typearrow_forwardThe figure below shows the life cycle of the fungus Neurospora. The adult stage of the Neurospora is a multicellular haploid. b) Neurospora has an arginine amino acid synthesis pathway shown below. Suppose I take the strain above that only grows with arginine supplements and cross it to a different mutant Neurospora strain that grows with arginine and citrulline supplements but not with ornithine supplements. Assuming gens A, B, and C are unlinked and there is only one mutation per stain: What percentage of the progeny will grow on ornithine? What percentage on citrulline? What percentage on arginine?arrow_forwardBased on Figure 17-35, write a sentence stating howtranslocation can lead to cancer. Can you think of another genetic cause of cancer?arrow_forward
- When considering the cause of the disease in a patient who is the child of an inbred couple, it was found that 4 enzymes in the lysosome were inactivated. When comparing the amino acid sequences of these four enzymes with the wild-type enzyme, no difference was found in the number and arrangement of amino acids. Given mutations that may be the cause of the patient's disease above.arrow_forwardYeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe and diagram how GAL1 gene expression will be changed (or unchanged) in 1) a ΔGal3 mutant and 2) a ΔGal4 mutant in comparison to WT. (Δ is a symbol for deletion.) WT: ΔGal3: ΔGal4:arrow_forwardThe genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY