BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 8SA
Summary Introduction
Introduction:
The change in the external and internal environment of a cell, allows the cell to respond. It is critical for life to respond to the change. The response of a cell changes the time and rate of gene expression.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Match the gene on the left with the gene category on the right.
ERBB2
E-cadherin
BRCA1
Cdk4
A.
oncogene
B.
proto-oncogene
C.
low expression in invasive cells
D.
tumor suppressor gene
Match the terms with the most suitable description. ___ operon a. makes a man out of you ___ Circadian rhythm b. binding site for repressor ___ Barr body c. can be epigenetic ___ differentiation d. inactivated X chromosome ___ mRNA zip code e. controls multiple genes ___ DNA methylation f. localization mechanism ___ eyeless g. speeds transcription ___ activator h. required for eye formation ___ SRY gene i. effect of regulatory loops ___ operator j. cells become specialized
_____ is the combination of a seat, elation, another modifications to the histones that allow for changes in DNA winding and unwinding
a. Epigentics
b. Histone code
c. Heterochromatin
d. Post translational modifications
Chapter 10 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 10 - Gene expression does not vary by ________. a. cell...Ch. 10 - Binding of _______ to _______ in DNA can increase...Ch. 10 - Prob. 3SACh. 10 - Mechanisms that govern gene expression do not...Ch. 10 - Muscle cells differ from bone cells because they...Ch. 10 - Prob. 6SACh. 10 - Prob. 7SACh. 10 - Prob. 8SACh. 10 - Which of the following includes all of the others?...Ch. 10 - Prob. 10SA
Ch. 10 - Prob. 11SACh. 10 - Prob. 12SACh. 10 - Prob. 13SACh. 10 - True or false? Gene expression patterns can be...Ch. 10 - Match the terms with the most suitable...Ch. 10 - Why are some genes expressed and some not?Ch. 10 - Do the same mechanism of governing gene expression...Ch. 10 - Prob. 3CTCh. 10 - The photos below show flowers from two Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A. Somatic cells are aslo called B. In irder to clone a gene, a gene is inserted into a:arrow_forwardThe key to epigenetic regulation is ________. a. controlling accessibility to transcription factors and RNA polymerase binding b. biochemical modification of binding factors c. physical modification of the DNAarrow_forwardMatch the terms with the most suitable description. ___ methylation a. makes a man out of you ___ SRY gene b. binding site for repressor ___ operator c. cells become specialized ___ Barr body d. can be epigenetic ___ differentiation e. inactivated X chromosomearrow_forward
- Mechanisms that govern gene expression do not operate during______ . a. transcription c. translation b. RNA processing d. knockoutsarrow_forward6. _____ is a DNA sequence. 1.Coactivator 2.Corepressor 3.Enhancer 4. Inducer 5.Transactivatorarrow_forwardMutations in the ras gene family induce normal cells to proceed into the replication cycle. This converts the ras gene from a ________ gene to a ________ gene. a. proto-oncogene; oncogene b. oncogene; proto-oncogene c. mutant; oncogene d. tumor suppressor; proto-oncogenearrow_forward
- Tightly coiled DNA is ________. a. known as hypermethylated b. translationally regulated c. transcriptionally inactivearrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardProteins that influence RNA synthesis by binding directly to DNA are called_____ . a. promoters c. operators b. transcription factors d. enhancersarrow_forward
- In chromatin modification, _____ adds an acetyl group while ______ removes it. a. HAT, HDAC b. HDAC,HAT c. HDAC, HACHOO d. HAT, SCARFarrow_forwardThe binding of ________ is required for transcription to start. a. a protein b. DNA polymerase c. RNA polymerase d. a transcription factorarrow_forwardA repressor is a __________ that _________ transcription. a. small effector molecule, inhibits b. small effector molecule, enhances c. regulatory protein, inhibits d. regulatory protein, enhancesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license