BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 10SA
Summary Introduction
Introduction:
The change in the external and internal environment of a cell, allows the cell to respond. It is critical for life to respond to the change. The response of a cell changes the time and rate of gene expression. In flowers, the floral identity genes are homeotic genes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
_____ are characteristic of cancer. a. Malignant cells b. Neoplasms c. Tumors
Cancer causing genes are called ________. a. transformation genes b. tumor suppressor genes c. oncogenes d. mutated genes
6. _____ is a DNA sequence.
1.Coactivator
2.Corepressor
3.Enhancer
4. Inducer
5.Transactivator
Chapter 10 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 10 - Gene expression does not vary by ________. a. cell...Ch. 10 - Binding of _______ to _______ in DNA can increase...Ch. 10 - Prob. 3SACh. 10 - Mechanisms that govern gene expression do not...Ch. 10 - Muscle cells differ from bone cells because they...Ch. 10 - Prob. 6SACh. 10 - Prob. 7SACh. 10 - Prob. 8SACh. 10 - Which of the following includes all of the others?...Ch. 10 - Prob. 10SA
Ch. 10 - Prob. 11SACh. 10 - Prob. 12SACh. 10 - Prob. 13SACh. 10 - True or false? Gene expression patterns can be...Ch. 10 - Match the terms with the most suitable...Ch. 10 - Why are some genes expressed and some not?Ch. 10 - Do the same mechanism of governing gene expression...Ch. 10 - Prob. 3CTCh. 10 - The photos below show flowers from two Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Name the types of mutations that may occur and describe how some of them happen. With regard to UV-induced mutations, think about the fact that most leaves last for just a few months and then are replaced by new leaves the next spring. The next time you are getting a suntan, remember that your dermis must last as long as you live.arrow_forwardAn individual can inherit a gene in which expression has been altered by an ________ change with no mutation of the gene sequence. Choose the description in column 2 that best matches each gene in column 1. p53 c-myc A. tumor suppressor gene B. oncogenearrow_forwardHow does gene activation lead to cell differentiation? Explain the correct answer and explain why the others are wrong. A. Different genes are activated in different cells, causing each cell to have a unique funcation B. The same genes are actives in every cell of your body, causing every cell to function the same C. Certain cells only have parts of DNA that causes cell deferentiation D. Unique genes are in different cells, causing each cell to have a unique functionarrow_forward
- Pollen contains the complete genetic material of the plant and is airborne. Describe the ways in which the spread of transgenes via pollen can be contained.arrow_forwardDuring X chromosome inactivation,______ . a. female cells shut down b. RNA sticks to a chromosome c. pigments formarrow_forwardA mutation in Ras that prevents Ras from hydrolyzing GTP. Would cause? Why? A. Increased proliferation B. Decreased proliferationarrow_forward
- Some herbicides, such as 2,4-D, are believed to make plant cells divide more rapidly than normal. Suggest why applying such herbicides would affect the survival of the plants.arrow_forwardLast week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to temperature. SSA1 can be said to display what? a. Antagonistic hypertrophy b. Agonistic pleiotropy c. Agonistic hypertrophy d. Antagonistic pleiotropy e. Reductive pleiotropy f. Modular pleiotropyarrow_forwardWhy are dominant mutations in proto-oncogenes generally not inherited? A. Inherited mutations in proto-oncogenes would not affect cell division rate B. Inherited mutations in proto-oncogenes would decrease cell division rate and no viable embryo would form C. Inherited mutations in proto-oncogenes would increase cell division rate and no viable embryo would form D. Dominant mutations in proto-oncogenes are always inheritedarrow_forward
- Embryonic stem cells have the potential to do all of the following except _____. a be rejected by a recipient's immune system b differentiate into almost any type of cell in the body c only able to grow into a similar type of cell d repair cells damaged by injury or diseasearrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardA. Mutation in chromosome 17 can result to galactosemia type 1 B. Mutation in chromosome 9 can result to galactosemia type 1 A. Both statements are incorrect B. Both statements are correct C. Statement B is correct D. Statement A is correctarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
What are Mutations and what are the different types of Mutations?; Author: Science ABC;https://www.youtube.com/watch?v=I16YlE8qTBU;License: Standard youtube license