
Concept explainers
Introduction:
Every organisms present in the environment contains cell. The cell is the basic “fundamental unit” of life. Cell performs a number of important functions. These are termed as cellular activities. Reproduction is also an important cellular activity. All the new cells are formed from the old cell. The process by which a cell produces its progenies is termed as reproduction.

Answer to Problem 1SA
Correct answer:
The single-celled prokaryotes reproduce asexually by mitosis and cytoplasmic division. Hence, the correct answer is option a.
Explanation of Solution
Reason for correct answer:
Option a. is given as “asexual reproduction of single-celled prokaryotes”.
The prokaryotes are simple organisms that lack a well-defined nucleus. The genetic material in prokaryotes lies freely in the cytoplasm. The unicellular prokaryotes reproduce asexually through mitosis and cytoplasmic division. Mitosis is a process in which the nucleus of the cell divides. Mitosis has the capability to maintain the number of chromosomes present inside the nucleus. The cytoplasmic division is the process in which the cytoplasm of the parental cell divides into two equal parts. These two parts are termed as daughter cells.
Reason for incorrect answer:
Option b. is given as, “development and tissue repair in multicelled species”.
Mitosis and cytoplasmic division are the methods of asexual reproduction. Mitosis is also involved in the development and tissue repair mechanisms in some multicellular organisms. However, the cytoplasmic division has no role in the development and tissue repair mechanism. Hence, option b. is incorrect.
Option c. is given as, “sexual reproduction in plants and animals”.
Mitosis and cytoplasmic division are the two ways of asexual reproduction. This indicates that mitosis and cytoplasmic division are not the methods of sexual reproduction. Hence, option c. is incorrect.
Hence, the options b., and c. are incorrect.
Mitosis and the cytoplasmic division are the two ways in which a unicellular prokaryote reproduces asexually. Thus, the correct option is a.
Want to see more full solutions like this?
Chapter 11 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning



