The codon chart is shown below, what amino acid sequence does the DNA sequence: 3' TCAGCTAGA 5' code for?

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Group of nucleotides that confers specificity for the appropriate aminoacyl-tRNA synthetase is…

A: tRNA  Transfer RNA or tRNA is help in the decoding of mRNA. It brings up the amino acid to the P…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: de, translate the mRNA into an amino acid sequence.

A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA  A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: ginine rine ginine cine Third letter DCAG UCAG UCAG

A: There are 64 possible codon out of which 3 codon do not code for any amino acid.  Thus 61 codon code…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…

A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…

Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…

A: CODONS 3 4 5 6 7 8 9   NORMAL PRO THR VAL THR THR ARG TRP   CODON CCC ACG GUG ACG ACA CGG UGG…

Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…

A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…

Q: DNA Sequence mRNA Sequence (codon) tRNA Sequence {anticodon) AMINO ACID Sequence

A: Introduction DNA (Deoxyribonucleic acid)serves as the genetic material of almost all organisms (some…

Q: * Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG…

A: Anticodons are nucleotide sequences that are the opposite of codons. They're located in tRNAs, and…

Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…

A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…

A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…

Q: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA…

A: Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…

Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…

A: The central dogma of life involves three major steps that include: DNA replication: This is the…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.