Put the following pieces of DNA in order that they would appear reading from the top (nearest the loadingpoint) to the bottom of a gel, with "first" meaning nearest the top.First[ Choqse[Choose]21,000 basepairs (bp)Second10,000 bp23 kilobases (kB)18 kB2,300 bpThird[Choose ]Fourth[ Choose][Choose]Fifth>><>

First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…

Put the following pieces of DNA in order that they would appear reading from the top (nearest the loading point) to the bottom of a gel, with "first" meaning nearest the top. ( Choqgel First [Choose] 21,000 basepairs (bp) 10,000 bp 23 kilobases (kB) 18 kB Second 2,300 bp Choose ] Third [ Choose] Fourth [ Choose ] Fifth

Put the following pieces of DNA in order that they would appear reading from the top (nearest the loading point) to the bottom of a gel, with "first" meaning nearest the top. ( Choqgel First [Choose] 21,000 basepairs (bp) 10,000 bp 23 kilobases (kB) 18 kB Second 2,300 bp Choose ] Third [ Choose] Fourth [ Choose ] Fifth

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.
That's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630
Both protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the immobilised pH gradient (IPG) strip with pH range of 4-7. After the electrophoresis and staining, only ONE band is observed on the middle of the IPG strip. The band is a protein band. Briefly explain why only the protein band and NOT the DNA band appear on the IPG strip.
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane. What if you had two different DNA fragments that were exactly the same length as measured in base-pairs. Would it be possible to distinguish them using this type of electrophoresis? How would they appear on a gel?
A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane. What is it about the chemistry of DNA that causes it to be uniformly negatively charged?
A DNA synthesizer “machine” is used to create short single stranded DNA of any given sequence. You have used the machine to create the following the DNA molecules: (DNA #1) 5’- CTACTACGGATCGGG – 3’ (DNA #2) 5’- CCAGTCCCGATCCGT – 3’ (DNA #3) 5’-AGTAGCCAGTGGGGAAAAACCCCACTGG-3’ Now you add the DNA molecules either singly or in combination to reaction tubes containing DNA polymerase, dATP, dCTP, dGTP, and dTTP in a buffered solution that allows DNA polymerase to function. For each of the reaction tubes, indicate whether DNA polymerase will synthesize any new DNA molecules, and if so, write the sequence(s) of any such DNAs. DNA #1 plus DNA #3 DNA #2 plus DNA #3 DNA #1 plus DNA #2 DNA #3 only
What size DNA fragment would be released after very mild digestion of chromatin with micrococcal nuclease? (This would represent a single cut per nucleosome.) 30 bp O 165 bp 146 bp 200 bp
The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||
You have 10 ul of DNA you want to cut with HindIII, and then run a gel, in order to cut out certain bands and purify the DNA from them. Since the DNA is pretty concentrated, you are going to cut it in a 50 ul total volume and then run it in 2 adjacent lanes of a gel, to avoid overloading the lanes. What are all the ingredients you need to put into a tube, how much of each, and what is the temperature ordinarily used? (Amount of HindIII might vary, but be safe and put in twice as much as you might normally use to cut less DNA)
A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?
Figure 9-22 shows the first steps in the process of making a DNA microarray, or DNA chip, using photolithography. Describe the remaining steps needed to obtain the desired sequences (a different fournucleotide sequence on each of the four spots) shown in the first panel of the figure. After each step, give the resulting nucleotide sequence attached at each spot.