How many nucleotides would be necessary to code for 10 amino acids? Please help, I am lost!

Q: What do you mean by ordered genetic code ?

A: Genetic code It is defined as the nucleotide sequence in DNA or RNA which determines the protein…

Q: c) What are essential fatty acids? What type of geometrical isomerism plays a vital role in…

A: In the recent two decades or more, lipid research in the life sciences has regained popularity,…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5'…

A: Introduction : Mutation is defined as a change in the DNA sequence. Mutation is an alteration that…

Q: What's number 14-16? Thank you

A: The hip bone (os coxae, innominate bone, pelvic bone, or coxal bone) is a large irregular bone,…

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: As you watch the video, answer the questions. The questions are in sequential order. 1) True or…

A: We are not supposed to use external links so answer are based in general point of view. Also in case…

Q: Suppose you are analyzing a nucleic acid sequence which contains guanine, cytosine, adenines, and…

A: DNA: DNA is a polymer made up of two polynucleotide chains that coil around one another to form a…

Q: What do you mean by lysozyme gene?

A: Lysozyme gene is a protein coding gene.

Q: Can you show me the step how you get the amino acid sequence?

A: An amino acid sequence refers to the linear arrangement of amino acids in a protein or peptide.…

Q: https://youtu.be/8kK2zwjRV0M Describe the purpose or theme of the video.   Question 2   What are…

A: Deoxyribonucleic acid, or DNA, in short, is one of the most complex molecules known. Its structure…

Q: What is a codon?

A: More than 150 amino acids are found in nature , but only 20 are synthesized during protein…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: You are trying to purify Protein 1 from a mix of 4 different proteins without denaturing the…

A: Ion exchange chromatography is a techniques that separates ions and polar molecules based on their…

Q: What do you mean by statins?

A: Drugs are used for the curing of various disease there are drugs for bacterial,viral,fungal etc…

Q: Write a DNA structure having 8 nucleotides.

A: Deoxyribose Nucleic Acid is double stranded polymer of purines and pyrimidines. As per Chargaff's…

Q: Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so…

A: Hydrogen bonds are a type of attractive interaction between an electronegative atom and a hydrogen…

Q: How many bases make up a codon? 10 3 O 1

A: Answer: 3

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution…

A: As per our company policy, the three parts are solved in case of interlinked question. If you want…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: o not copy from anywhere please does a 50% similarity score for two proteins mean that they're the…

A: Proteins are made up of polypeptides, which contain one or more long chains of amino acid residues.…

Q: f you have 960 nucleotides, how many codons do you have?

A: Introduction DNA is a genetic material of our body. DNA is a self replicating molecule. The…

Q: explain why the order is 3–1-4-2 and not another way, thank you so much

A: Shotgun sequencing It is a method used in laboratories to identify the DNA sequence of a genome. The…

Q: Task 2: Find where the primers bind to in the gene sequences on Moodle (kan has been provided for…

A: PCR or polymerase chain reaction is a rapid and versatile in vitro technique for amplification of…

Q: Which protein would elute last from a cation exchange column using buffer at pH 7.5? Explain your…

A: The proteins have net charge arising mainly from the amino acid side chain which may either has…

Q: DNA is a nucleic acid that consists of thousands of smaller, repeating units called nucleotides.…

A: DNA and RNA are called nucleic acids. They are made of small monomers called nucleotides.

Q: JUG | CUCAC UCAG JU JC JA U IC UCG CCU Leu CCC lle CCA CCG ACU ACC ACA Met ACG GCU 000 UAG CAU Pro…

A: This is the gene expression process in which two steps are followed.The first one being…

Q: DNA is composed of thousands of nucleotides, each of them made of a phosphate group, sugar and a…

A: Deoxyribonucleic acid or DNA is a fundamental molecule present in all living things that transports…

Q: Frameshift mutation _____________________ Select one: can result in a completely new codon sequence…

A: These mutations include insertions or deletions in between the nucleotide sequence of the genome,…

Q: is the term used to describe the genetic code because a codon specify only for one amino acid is the…

A: 1. The genetic code is UNAMBIGUOUS i.e., each triplet ( codon) specifies only a single amino acid.…

Q: Crick and Watson, whose work greatly contributed to the discovery of the double helical structure of…

A: Made by Rosalind Franklin utilizing a procedure called X-beam crystallography, it uncovered the…

Q: Each of the following sequences has a total of 20 nucleotides (note that the first six are the same…

A: Introduction Stem-loop formation occurs in single-stranded RNA when two regions of the same strand…

Q: What is TFIIB ?

A: ANSWER:  Transcription factor II B (TFIIB) is a transcription factor that helps in the formation of…

Q: Which reading frame gives you the longest amino acid sequence? 5'3 Frame 1 5'3 Frame 2 5'3 Frame…

A: In the world of molecular biology, understanding reading frames is crucial for deciphering genetic…

Q: Base Pairing DNA RNA A G C T Match the RNA nucelotides to the DNA template strand.... G U C Tolos…

A: This task involves matching RNA nucleotides to a DNA template strand based on the complementary base…

Q: Question S end shoephete adre GLare H H oyaene Pyimdine bemes HO OH a. Label the strands as being…

A: Biomolecules also known as biological molecule is any of the numerous substances that are produced…

Q: DNA sequence, while a substitution will affect only the one codon (set of: DNA. For example:…

A: Mutation is defined as the change in the DNA sequence. These are sudden changes caused by various…

Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu

Nitrogen metabolism

Nitrogen metabolism is the synthesis, utilization or uptake, breakdown, and excretion of nitrogenous compounds in the body. The nitrogen metabolism encompasses nitrogen fixation, biosynthesis, and the breakdown of amino acids, purines, and pyrimidine. Since nitrogen-containing compounds are required for various life processes, nitrogen is an important element of life.