Build up your DNA Tom there your MRNA and your protelm 3 ATATTIT TACTTCAAACOGATT AUGAAGUUUGGCUAA Met REMEMBER: start codon AUG Stop codon: UAA, UAG, UGA
Q: Please I need help understanding this question
A: A biliary obstruction is blockage of bile dicts. The bile ducts are responsible for carrying bile…
Q: Please I need help understanding this question
A: Erythropoeisis is a word which is derived from two Greek words erythro means " red blood cell"…
Q: Samoa Savaii Question 7 Apia A big outbreak of measles began in Samoa in September 2019. The…
A: Contagious disease caused by the measles virus is called measles. The symptoms appear 10 to 12 days…
Q: This membrane is present on nal thoracić wall O parietal pleura O internal pleura O. visceral pleura
A: Introduction: The serous membrane lining the thoracic cavity and the lungs is known as the pleura.…
Q: 50 40 P 30 10 10 20 30 40 50 N The oval in the graph illustrates the cyclically changing numbers of…
A: Introduction: The organisms that feed on another organism for survival is referred to as predator.…
Q: ncestral hordate
A: Chordates are divided into 3 subphyla: subphylum Craniata (fish, amphibians, reptiles, birds, and…
Q: I need help this question please answer
A: We know Compact bone tissue and spongy bone tissue are two types of bone tissue, which is found in…
Q: Refer to the accompanying figure. In which part of the muscle fiber are calcium ions stored?
A: Muscle tissue contains something called muscle fibers. Muscle fibers consist of a single muscle…
Q: Which of the following statements regarding graded potentials is FALSE? Graded potentials: diminish…
A: Graded potential It refers to the graded response or graded depolarization, which is a change in the…
Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…
A: According to Bartleby guidelines, the first three subparts have been answered kindly post the…
Q: Productivity in deep (cold water) reef communities that exist below the euphotic zone is dominated…
A: Ocean is defined as the continuous salt water body where it comprises of various large and small…
Q: Chapter 16 The Endocrine System 17 dict It: Hormones and Homeostasis Predict the hormonal response…
A: Hormones are chemical messengers that are secreted from the ducts in the body. They may function at…
Q: Organ Lymph nodes Tonsils 4. Thymus along the course of the lymphatic vessels 2. 5. 6. Location…
A: As per Bartleby guidelines, an expert cannot answer more questions at a time. So, kindly post other…
Q: The zona reticularis produces androgens under stimulation of (full name of the hormone).
A: The zona reticularis is that the inner layer of the cortex, about the size of the zona glomerulosa…
Q: Please I need help understanding this question
A: Blood is a fluid connective tissue. Human blood contain blood plasma and blood corpuscles. Blood…
Q: Please I need help understanding this question
A: Hormones are biomolecules that are synthesized at a place and worked in another place most of the…
Q: In hemolytic disease of newborn, mixing of fetal and maternal blood can stimulate the mother's…
A: Hemolytic disease of newborn is a type of blood disorder which arises due to mixing of a maternal…
Q: The largest paranasal sinus is O ethmoid O sphenoid maxillary O pharyngeal
A: Introduction: The sinuses are facial bone chambers found in the face and skull bones. The paranasal…
Q: I need help answer this question
A: As we know the Nervous system plays a major role in transmitting signals between different parts of…
Q: What does transferrin carry in the blood?
A: Blood contains many proteins which aids in the transport of ions and molecules inside the tissues.…
Q: # Metoprolol 25 Mg PO is ordered. Metoprolol is available as 50 Mg tablet. How many tablet would the…
A: The drug metoprolol has been prescribed in a dose of 25 mg by mouth(dose prescribed)The drug…
Q: I am not sure how to answer this question
A: Red/green colorblindness is an X-linked recessive trait. Let’s represent the normal allele by X and…
Q: Trace the pathway of blood circulation in the lamprey from the head region to the tail by putting…
A: Lamprey does not have a true lymphatic system but blood circulation occurs in a systematic way.
Q: All the following is true of CO poisoning éxcépt CO is an odorless gas O CO has higher affinity to…
A: Carbon Monoxide when breathed binds to the haemoglobin so strongly that it doesn't let oxygen bind…
Q: The pulmonary arteries carries blood the lung. oxygenated; to
A: The blood has nutrients and gases that are required by the cells to perform vital functions in the…
Q: I need help on this question
A: Carbohydrates are required for supporting infinite life forms on Earth, and carbon dioxide is a…
Q: 1. Which substance in the following reaction is being reduced? CHOH + NADH + H* > CHSOH + NAD+…
A:
Q: Name two structures that serve as passageway for BOTH food or liquids and air? Name
A: Introduction: The respiratory system of an individual consists of organs that aid in respiration.…
Q: Please I need help understanding this question
A: The endocrine system is the ductless system that secretes its secretions directly into the…
Q: Please I need help understanding this question
A: Protein is an amino acid-based macromolecule that plays a crucial role in the body. Carbon,…
Q: Please I need help understanding this question
A: The pharynx is located in between the nasal cavity and the oesophagus or larynx. Different lymphatic…
Q: What is the excitation and emission maxima of EGFP and how could you use these properties and an…
A: GFP (stands for Green Fluorescent Protein) is a protein that exhibits bright green fluorescence when…
Q: A person with a type B+ blood type can safely receive blood from all of these donors except
A: The Landsteiner grouping has four blood groups namely A,B,AB,O. The Rhesus factor was discovered…
Q: When the gene encoding a certain cellular kinase is deleted, the resulting mutant cells arrest in…
A: Answers : fusion protein are the proteins which are synthesized in the laboratory for the…
Q: Which of the following correctly describes a typical alpha helix protein secondary structure?
A: Protein play wide variety of essential function in our body. They provide strength and structural…
Q: Patient B 128 256 512 1024 Patient C Patient D 128 128 128 128 In Table 18.1, who most likely is…
A: The secondary immune response occurs as a result of subsequent contact with the same antigen. In…
Q: The distinctness of a subspecies: can be measured by clear genetic differences. is because of mating…
A: According to biological classification, living organisms can be classified based on seven taxonomic…
Q: Please I need help understanding this question
A: The endocrine system consists of endocrine glands which secrete hormones directly in blood. Hormones…
Q: Which of these proteins functions to store or transport iron? O hemoglobin O hemosiderin O…
A: Transport and storage of iron are vital for the body to function properly. Iron is the main…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Label the 5’ and 3’ untranslated regions and the start and stop codons on your mRNA.TACCCCGAGTCCCTGGCGTTAAAACAGTGCCGAATCFIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASE
- Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letterRNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
- Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GTranscribe the following strand in Mrna, then translate it into amino acids
- Codon chart: We interpret mRNA 3 base pairs at a time. This is known as a codon. A codon table can be used to translate a genetic code into an amino acid sequence. The full set of relationships between codons and amino acids (or stop signals) is called the genetic code. The genetic code is often summarized in a table like the one below. Second letter A G UUU UUC J UGU Cys UCU) UCC UCA UCGJ UAU U Phe Tyr UACS UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UUG FLeu G CUU ) CỤC CUA CUG CCU ) ССС ССА CCG CGU CGC Arg CAU) CÁC His САА Leu Pro CGA Gin CAG CGG AUU AAU ACU АСC ACA Asn AGU Ser AAC JAsh AGC. AUC le A AUA AGA Arg Thr AAA AAG. }Lys A AUG Met ACG AGG J G GUU GUC G Val GUA GUG GCU) GCC GCA GCG GAU1 GACS GAA) GAG Glu GGU GGC Gly U C A Ala GGA GGG] G First letter UUAG Third letterIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- Ghe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…