2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino acid sequence of the polypeptide using the one-letter notation. The DNA sequence given is in the 3' to 5' direction. CCGCTTTTACTCTGATAGACGAGTGGCGAAAATGAG ACTATCTGCTCA

The results of a paternity test using short tandem repeats are listed in the table below. Whos the daddy? How sure are you?

Match the terms with the best description. __ genetic message a. protein-coding segment __ promoter b. KN A polymerase binding site __ polysome c. read as base triplets __ exon d. removed before translation __ genetic code e. occurs only in groups __ intron f. complete set of 64 codons

Match the terms with the best description. ______ genetic message a. protein-coding segment ______ promoter b. transcription begins here ______ polysome c. read as base triplets ______ exon d. removed before translation ______ genetic code e. occurs only in groups ______ intron f. 64 codons ______ anticodon g. destroys ribosomes ______ RIP h. often causes a frameshift ______ deletion i. enzymatic RNA ______ rRNA j. binds to a codon

If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following sequence: 3'-AATGCTAC-5' 3'-CATCGTAA-5' c. 3'-TTACGATG-5' d. 3’-GTAGCATT-5'

How many nucleotides are in 12 mRNA codons? 12 24 36 43

Which of the following statements is false? a. GTP is an energy source during various stages of translation. b. In the ribosome, peptidyl transferase catalyzes peptide bondformation between amino acids. c. When the mRNA code UAA reaches the ribosome, there isno tRNA to bind to it. d. A long polypeptide is cut off the tRNA in the A site so its Metamino acid links to the amino acid in the P site. e. Forty-two amino acids of a protein are encoded by 126nucleotides of the mRNA.

James sees an online ad for an at-home genetic test that promises to deliver personalized nutritional advice based on an individuals genetic profile. The company can test for genetic variations, the advertisement states, that predispose individuals to developing health conditions such as heart disease and bone loss or that affect how they metabolize certain foods. If such variations are detected, the company can provide specific nutritional advice that will help counteract their effects. Always keen to take any steps available to ensure the best possible health for their family, James and his wife (Sally) decide that they both should be tested, as should their 11-year-old daughter (Patty). They order three kits. Once the kits arrive, the family members use cotton swabs to take cell samples from their cheeks and place the swabs in individually labeled envelopes. They mail the envelopes back to the company, along with completed questionnaires regarding their diets. Four weeks later, they receive three individual reports detailing the test results and providing extensive guidelines about what foods they should eat. Among the results is the finding that James has a particular allele in a gene that may make him vulnerable to the presence of free radicals in his cells. The report suggests that he increase his intake of antioxidants, such as vitamins C and E, and highlights a number of foods that are rich in those vitamins. The tests also show that Sally has several genetic variations that indicate that she may be at risk for elevated bone loss. The report recommends that she try to minimize this possibility by increasing her intake of calcium and vitamin D and lists a number of foods she could emphasize in her diet. Finally, the report shows that Patty has a genetic variation that may mean that she has a lowered ability to metabolize saturated fats, putting her at risk for developing heart disease. The report points to ways in which she can lower her intake of saturated fats and lists various types of foods that would be beneficial for her. A number of companies now offer genetic-testing services, promising to deliver personalized nutritional or other advice based on peoples genetic profiles. Generally, these tests fall into two different categories, with individual companies offering unique combinations of the two. The first type of test detects alleles of known genes that encode proteins that play an established role in, for example, counteracting free radicals in cells or in building up bone. In such cases, it is easy to see why individuals carrying alleles that may encode proteins with lower levels of activity may be more vulnerable to free radicals or more susceptible to bone loss. A second type of test examines genetic variations that may have no clear biological significance (i.e., they may not occur within a gene or may not have a detectable effect on gene activity) but have been shown to have a statistically significant correlation with a disease or a particular physiological condition. For example, a variation may frequently be detected in individuals with heart disease even though the reason for the correlation between the variation and the disease may be entirely mysterious. Do James and Sally have any guarantees that the tests and recommendations are scientifically valid?

James sees an online ad for an at-home genetic test that promises to deliver personalized nutritional advice based on an individuals genetic profile. The company can test for genetic variations, the advertisement states, that predispose individuals to developing health conditions such as heart disease and bone loss or that affect how they metabolize certain foods. If such variations are detected, the company can provide specific nutritional advice that will help counteract their effects. Always keen to take any steps available to ensure the best possible health for their family, James and his wife (Sally) decide that they both should be tested, as should their 11-year-old daughter (Patty). They order three kits. Once the kits arrive, the family members use cotton swabs to take cell samples from their cheeks and place the swabs in individually labeled envelopes. They mail the envelopes back to the company, along with completed questionnaires regarding their diets. Four weeks later, they receive three individual reports detailing the test results and providing extensive guidelines about what foods they should eat. Among the results is the finding that James has a particular allele in a gene that may make him vulnerable to the presence of free radicals in his cells. The report suggests that he increase his intake of antioxidants, such as vitamins C and E, and highlights a number of foods that are rich in those vitamins. The tests also show that Sally has several genetic variations that indicate that she may be at risk for elevated bone loss. The report recommends that she try to minimize this possibility by increasing her intake of calcium and vitamin D and lists a number of foods she could emphasize in her diet. Finally, the report shows that Patty has a genetic variation that may mean that she has a lowered ability to metabolize saturated fats, putting her at risk for developing heart disease. The report points to ways in which she can lower her intake of saturated fats and lists various types of foods that would be beneficial for her. A number of companies now offer genetic-testing services, promising to deliver personalized nutritional or other advice based on peoples genetic profiles. Generally, these tests fall into two different categories, with individual companies offering unique combinations of the two. The first type of test detects alleles of known genes that encode proteins that play an established role in, for example, counteracting free radicals in cells or in building up bone. In such cases, it is easy to see why individuals carrying alleles that may encode proteins with lower levels of activity may be more vulnerable to free radicals or more susceptible to bone loss. A second type of test examines genetic variations that may have no clear biological significance (i.e., they may not occur within a gene or may not have a detectable effect on gene activity) but have been shown to have a statistically significant correlation with a disease or a particular physiological condition. For example, a variation may frequently be detected in individuals with heart disease even though the reason for the correlation between the variation and the disease may be entirely mysterious. Do you think that companies should be allowed to market such tests directly to the public, or do you believe that only a physician should be able to order them?

James sees an online ad for an at-home genetic test that promises to deliver personalized nutritional advice based on an individuals genetic profile. The company can test for genetic variations, the advertisement states, that predispose individuals to developing health conditions such as heart disease and bone loss or that affect how they metabolize certain foods. If such variations are detected, the company can provide specific nutritional advice that will help counteract their effects. Always keen to take any steps available to ensure the best possible health for their family, James and his wife (Sally) decide that they both should be tested, as should their 11-year-old daughter (Patty). They order three kits. Once the kits arrive, the family members use cotton swabs to take cell samples from their cheeks and place the swabs in individually labeled envelopes. They mail the envelopes back to the company, along with completed questionnaires regarding their diets. Four weeks later, they receive three individual reports detailing the test results and providing extensive guidelines about what foods they should eat. Among the results is the finding that James has a particular allele in a gene that may make him vulnerable to the presence of free radicals in his cells. The report suggests that he increase his intake of antioxidants, such as vitamins C and E, and highlights a number of foods that are rich in those vitamins. The tests also show that Sally has several genetic variations that indicate that she may be at risk for elevated bone loss. The report recommends that she try to minimize this possibility by increasing her intake of calcium and vitamin D and lists a number of foods she could emphasize in her diet. Finally, the report shows that Patty has a genetic variation that may mean that she has a lowered ability to metabolize saturated fats, putting her at risk for developing heart disease. The report points to ways in which she can lower her intake of saturated fats and lists various types of foods that would be beneficial for her. A number of companies now offer genetic-testing services, promising to deliver personalized nutritional or other advice based on peoples genetic profiles. Generally, these tests fall into two different categories, with individual companies offering unique combinations of the two. The first type of test detects alleles of known genes that encode proteins that play an established role in, for example, counteracting free radicals in cells or in building up bone. In such cases, it is easy to see why individuals carrying alleles that may encode proteins with lower levels of activity may be more vulnerable to free radicals or more susceptible to bone loss. A second type of test examines genetic variations that may have no clear biological significance (i.e., they may not occur within a gene or may not have a detectable effect on gene activity) but have been shown to have a statistically significant correlation with a disease or a particular physiological condition. For example, a variation may frequently be detected in individuals with heart disease even though the reason for the correlation between the variation and the disease may be entirely mysterious. What kinds of regulations, if any, should be in place to ensure that the results of these tests are not abused?