Direction: Please answer letter B and email C thoroughly and explain your answer. Thank you so much. C. The following is the amino acid sequence for a smallsection of a protein: Methionine-phenylalanine-cysteine-glutamine-valine-tryptophan- isoleucine-proline-aspartate-serine-asparagine1. Find the mRNA triplets which code for thissequence.2. Use the mRNA to determine the DNA codon strand.3. Construct a complete double stranded DNAmolecule for this small protein.cdn.fbsbx.com B. Below is a short segment of a DNA molecule. Translatethe DNA codon into mRNA. Use your data sheet to findthe sequence of the amino acids coded for.TACCATGAGAATTGTGGTCACCTTΤΤΤΑΤGGTACTCTTAACACCAGTGGAAAA A1. mRNA:2. Amino Acid:3. If the nucleotide at position 23 in the first strand ofDNA ischanged to "A", what effect would this have on theprotein produced?

Transcription is the process of conversion of DNA to RNA, in this process the template strand is…

B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data sheet to find the sequence of the amino acids coded for. TACCATGAGAATTGTGGTCACCTT ΤΤΤΑΤ GGTACTCTTAACACCAGTGGAAA A A 1. mRNA: 2. Amino Acid: 3. If the nucleotide at position 23 in the first strand of DNA is changed to "A", what effect would this have on the protein produced?

B. Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA. Use your data sheet to find the sequence of the amino acids coded for. TACCATGAGAATTGTGGTCACCTT ΤΤΤΑΤ GGTACTCTTAACACCAGTGGAAA A A 1. mRNA: 2. Amino Acid: 3. If the nucleotide at position 23 in the first strand of DNA is changed to "A", what effect would this have on the protein produced?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

In your initial reply, include the following: a medical term where when you change the prefix, you change the entire meaning of the medical term. Explain both terms meanings. How might this change impact the patients care? Sample response: 1. A medical term that comes to mind when changing prefixes is thyroid. There is hypothyroidism and hyperthyroidism. 2. Hypothyroidism is when the thyroid gland is not performing enough of the hormone and slowing down ones metabolism. Hyperthyroidism is when the gland becomes enlarged due to too much of the thyroid hormone being produced. It can also increase a persons metabolism rate. 3. When treating hypothyroidism a person is usually give a synthetic medication to make up for the loss of those hormones. Those with hyperthyroidism are give medication that will get absorbed into the gland, slowing production of the hormone and making it shrink.
Give an example of a common grammatical mistake (with the correction in parenthesis). Name a spelling mistake that you often make (with the correct spelling in parenthesis). Do you have any suggestions on how to write clearly and correctly when entering documentation in the patient's medical record?
tected View Saved V View Help need to edit, it's safer to stay in Protected View. sabled. Reactivate Search Enable Editing Mental Health Case: George Palo Documentation Assignments 1. Document your findings related the focused assessment regarding George Palo's possible cognitive decline and depression. Include his responses to your assessment. Q Search 2. Document your findings related to the assessment of George Palo associated with the Geriatric Depression Scale screening tool. Include his responses to your assessment. 3. Referring to your feedback log, document all nursing care provided and George Palo's response to this care. 4. Document all patient teaching provided to George Palo regarding assessments and safety issues, and his response to the teaching. 5. Document your handoff report in the SBAR format to communicate George Palo's future needs.
MAKE A DECISION: What do you think is the best course of action for Cory, his parents, and the school? a. Cory will always have social challenges. He should be encouraged to participate in social skills training, but realize he will have to learn to live within the constraints of his disability. b. Cory would benefit from some extra assistance such as social skills training either individually or in a group. He should also be provided with at least a part-time aide who can guide him with social interactions. c. Cory should probably be completely removed from mainstream programs temporarily until he can learn the social skills he needs to function in a general setting. d. Cory appears to be unable to function when mainstreamed. He should either be home-schooled or placed in a special school designed for children with disorders such as schizophrenia. Think about the issues that influenced your recommendation for Cory. Why did you choose the option that you did? Consider the following…
Hello, Can you please help me to answer next question abaut the case? Case: Mr. Hollon is a retired 76-year-old male who spent his entire working career as a fire fighter. He has a 22-year history of type 2 diabetes; he also has hypertension and emphysema. He is an active smoker (52-pack year smoking history), although he has attempted to stop smoking on several occasions. He wears a hearing aid in each ear because of hearing loss as a result of working around machinery for several years. Thinking in sensory perception: List three clinical manifestations that the cues suggest need to have further investigation or assessment. Thank you in advance!
Please answer very soon
How would you demonstrate respect for the patient given their gender
HandWritten on white page please, otherwise dislike and please give correct answer only!!
How would you display your professional skills while taking the patients chief complaint
https://mylearning.suny.edu/d21/le/content/1496105/viewConten Ch 9 Medical Record Activity Page 1: What is Cindy's chief complaint or reason for visit? 1 Page 2: 21 Page 3: 3> Page 4: 41 Page 5: 5 Page 6: Cindy is a 17-year-old high school student. She leads an active social life, gets good grades, and is a member of the track team. About two weeks ago she became ill with what she thought was the flu. Her signs and symptoms included sore throat, enlarged and tender lymph nodes in her neck, inflamed tonsils, headache, fever, muscle aches and fatigue and loss of appetite. She expected to feel better by now, but she still has many of the symptoms. Her mother took Cindy to their family physician for evaluation. Upon examination the physician notes that Cindy has swollen lymph nodes in her neck and armpits, her spleen is enlarged. Based on her symptoms and examination the physician diagnosed Cindy with the Epstein-Barr virus. He explained that there is no specific cure, but that treatment…