Go ahead and repeat the translation process but for Transcription translation Sequence II. Once you have formed the polypeptide from Sequence II select which amino acid is in the C-terminus Pro Glu Trp lle Cys His

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: The collection of instructions that allow living cells to convert information contained in genetic…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…

A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…

Q: Second letter of codon U U UC UA UG U CU CC CA CG First letter of AU AC AA AG codon (5'-end) GU GC…

A: The genetic code may be defined as a collection of principles that living cells use to translate…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…

A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…

Q: rms/d/e/1FAlpQLSf4pNBODhtp6XZ5MLiy4aJP4SwUyY88r3DcxvneABoarLXNAw/viewscore?viewscore=A... AD Tyr Cys…

A: During Protein synthesis messenger RNA contains information in the form of its triplet codons which…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA 1.…

A: Information coded in the DNA is transcribed in the form of mRNA, these mRNA then translate this…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: AUG is the most common start codon found in translated genes. Which of the following is true of…

A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…

Q: Draw a schematic of translation. Include the following: • 5'and 3'of MRNA nucleic acid • N and C of…

A: The process in which information on mRNA is translated in protein is called as translation.

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: 11. The template DNA for the beginning a gene is 3' – GATACATGAGGCGATACG – 5'. What mRNA transcript…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…

A: An arrow has been given that signifies in which direction, translation is happening. Translation…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: HORSE: Use your translated amino acid sequences to determine the phenotypes to include in your…

A:

Q: Which of the following processes occur on the mRNA during and/or after transcription but before…

A: Introduction  Gene expression is the process of activating a particular gene so that messenger RNA…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…

A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 1. What is the sequence of the peptide that would result following translation with a ribosome?…

A: A codon is a three-nucleotide (tri-nucleotide) sequence of DNA or RNA that corresponds to a specific…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA MRNA | 1.…

A: Transcription is process of formation of mRNA from DNA template by addition of complementary…

Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino…

A: Trancription It refers to the process of copying the genetic sequences of DNA into mRNA. Translation…

Q: The queation on my assignment is select the description of an exon? the answers they give are: 1.…

A: An exon is a coding region of the gene that codes for amino acids. In eukaryotes, genes are made up…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG 2. Telomerase…

A: The image shows 10 statements. We have to determine whether the statement is True or False. The…

Q: me e File Content Edit X view Tator Biol 140 X BOBILI Content X Begin:…

A: This worksheet is related to  transcription and translation which are related to the synthesis of…

Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…

A: We all know that central dogma is a very basic and important procedure in every cell.There are…

Q: All of the following are true for an mRNA once it has been transcribed from its DNA template…

A: Transcription is the synthesis of RNA from a DNA template where the code in the DNA is converted…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…

Q: ng translation initiation, when does the 30S ribosomal subunit bind to the 50S ribosomal subunit?…

A: 30S and 50S subunit are the two subunits of the ribosome. 30S is considered the smaller sub unit and…

Q: Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: Here we are given the 3'→5' directing strand of the DNA . This strand is the template strand. During…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.