Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR. b. It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR. c. It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR. d. It will bind to the bottom strand on the right side of the fragment, and is unsuitable to amplify the fragment by PCR.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TTGCATCG 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA, and will this primer work as part of a pair to successfully amplify this fragment of DNA?
5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA
3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT
It will bind to the bottom strand on the left side of the fragment, and is suitable to amplify the fragment by PCR.
It will bind to the top strand on the left side of the fragment, but it is unsuitable to amplify the fragment by PCR.
It will bind to the top strand on the right side of the fragment, but it is unsuitable to amplify the fragment by PCR.
It will bind to the bottom strand on the right side of the fragment, and is unsuitable to amplify the fragment by PCR.
It will bind to the top strand on the left side of the fragment, and it is suitable to amplify the fragment by PCR.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps