draw the following instructions in haworth projection 1. ADP 2. UTP 3. dTdP 4. dCMP 5. UTP 6. A polynucleotide strand in the 5'---3' direction: AUG
Q: When a neuron is in the relative refractory period, a stimulus has to be stronger than normal to…
A: In the phase of the neural action potential cycle known as the relative refractory period, a neuron…
Q: Anatomy of a bone: Below explain what the five marked places are and describe the function. 5. Blood…
A: The more dense and durable of the two forms of bone tissue is termed compact bone, commonly known as…
Q: Density-dependent factors __________. have a greater impact at higher population densities are…
A: In ecology, a density-dependent factor, also known as a regulating factor, is any force that affects…
Q: What is one anatomical difference between Australopithecines and other early hominins, such as Ardi?…
A: The answer is: B. Ardi had a divergent big toe while the Australopithecines had non-divergent big…
Q: In peas, a gene controls flower color such that R= purple and r = white. In an isolated pea patch,…
A: The laws says "In absence of forces that change gene frequencies, relative frequency of an allele…
Q: All of the following are true of DNA EXCEPT: Group of answer choices A. It contains the base…
A: Nucleic acids are the one of important biomolecules that serve as the genetic material of biological…
Q: Using the table, give the different types of feathers, their location in the body of the bird, and…
A: Feathers are a characterizing feature of avian anatomy, serving a large number of pivotal parts…
Q: Using the picture serial dilution scheme and the following information (plate A has 276 colonies,…
A: A serial dilution is the process by which a solution generally containing bacterial culture is…
Q: 1. The pH of the stomach is integral to how food digests. Explain why this is and what can happen…
A: Digestion refers to the process of mechanically and enzymatically breaking food into substances that…
Q: Fungi go through many changes in ploidy (the number of chromosome sets in a cell) through their…
A: Basidiomycete are the class of fungi that form basidia as the fruiting body. The development of…
Q: Description Substrate binds to enzyme at the active site. Active site of the enzyme encourages…
A: Enzymes are proteins that help to speed up chemical reactions in the body.Substrate is a compound…
Q: QUESTION 8 Emergent properties of living systems are defined as properties that O are apparent only…
A: A unicellular organism is an organism that consists of only a single cell, such as an amoeba,…
Q: G1 Prophase Prophase I Prophase II Gametes chromatids chromosomes tetrads
A: The indirect process of cell division in which the chromosomes of parent cells divide once, but…
Q: Multiple Matching. Fill in the blanks with the words below that apply. 18. ________ site of protein…
A: DNA is the genetic material of living organism that is made up of two polynucleotide strands. DNA…
Q: Using the table, give at least 10 exoskeletons found in animals, source, its description and state…
A: Exoskeleton animals, often referred to as exoskeletal animals or arthropods, are a variety of…
Q: Taking into account that the diffusion constant of O2 D = 1000 um2/s, how long will it take for O2…
A: The basic structural and functional unit of organisms is the cell, which has an aqueous compartment…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Pyruvate oxidation is a crucial metabolic process that occurs in the mitochondria of eukaryotic…
Q: help me
A: Skull, vertebral column and rib cage together makes the axial skeleton of the body. Skull bones…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: The biochemical processes in living things that involve the synthesis (anabolism) and breakdown…
Q: DNA that is typically loosely spread out as thin threads within the nucleus is known as ________.…
A: The DNA that is typically loosely spread out as thin threads within the nucleus is known as…
Q: woman with severe discoloration of her tooth enamel has four children with a man who has normal…
A: The genes can exist in two versions called "allles", either as dominant where they are expressible…
Q: Lumbosacral Coccyge nerve Posterior view What does "A" represent? spinal nerves conus medullaris…
A: The spinal cord is a lengthy band of tissue that resembles a tube. It ties your brain and lower back…
Q: Which of the following molecular targets would lead to the greatest impact on the production of ATP…
A: During cellular respiration, a number of related metabolic reactions take place inside of cells to…
Q: The diagram of a gamete below depicts a single chromosome within a gamete. The bars spanning the…
A: The term "genetic diversity" describes the wide range of genetic traits present in a population or…
Q: 3. Which is an example of a complex lipid? Fats, oils and waxes a. b. C. d. 4. Cells are primarily…
A: Complex lipid:A complex lipid is a form of lipid molecule that consists of extra chemical groups or…
Q: Infectious Disease - Tuberculosis (TB) Characterization of etiologic agent Life cycle or…
A: Note:- Sorry, as per honor code we are not allowed to share personal opinions, and are not allowed…
Q: Each nucleotide pair of a DNA double helix weighs about 1 × 10–21 g. The human body contains…
A: DNA is a polynucleotide and each strand of DNA is made up of certain numbers of nucleotide, this is…
Q: Match the terms in the left column to the appropriate blanks on the right. Terms can be used once,…
A: Evolution is the change in the frequency of traits in a population over time. Due to the adaptions…
Q: animals in which of the following classes possess adductor muscles, labial palps, and use their…
A: All these classes that is bivalvia, cephalopoda, polyplacopora and gastropoda are all the classes…
Q: What structure is released from a mature (Graffian) follicle during ovulation? B) After…
A: The female reproductive cycle is a highly intricate and tightly controlled process. Ovulation is a…
Q: A man and woman both have brown eyes. One of their children has blue eyes. How is that possible?…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Cellular Metabolism] Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End…
A: Fermentation is the process in which microorganisms convert carbohydrates like starch or sugar into…
Q: The elodea cell is in what solution? O 0.9% NaCl distilled water O 0.3% NaCl O 10% NaCl
A: If two solutions with different osmotic potential are separated by a semipermeable membrane that…
Q: THEME 2: Observe the figure below depicting cells undergoing meiosis and indicating which ones have…
A: Meiosis is a sort of cell division that takes place in sexually reproducing organisms and produces…
Q: Label this figure to demonstrate your understanding of T-cell activation. Perforins and Memory CD8…
A: The process by which an antigen-presenting cell (APC) activates a T-cell is known as T-cell…
Q: A biologist examines a series of cells and counts 160 cells in interphase, 20 cells in prophase, 6…
A: Cell cycle or cell division is the series of events which takes place in a cell and that divides the…
Q: The connective tissue is a Tissue that supports, protects, and gives structure to other tissues and…
A: The tissues which are derived from embryonic mesoderm, present throughout the body to support and…
Q: Which groups of individuals must show the same phenotype in order to produces a 12:3:1 phenotypic…
A: Genes come in pairs and are responsible for the inheritance and expression of the associated…
Q: DNA footprinting is a technique that can be used to identify: A region of DNA that has been damaged…
A: DNA footprinting is a technique that is used to identify or recognise the interaction between DNA…
Q: epistatic phenotype in recessive epistasis?
A: Genetics is a branch of biology concerned with the study of genes, genetic variation, and heredity…
Q: Can you help me create a dichotomous key for these miccoorganisms and tests? Micoorganisms:…
A: A dichotomous key is a tool used in taxonomy to identify and classify organisms based on specific…
Q: What happens during spermiogenesis in the male seminiferous tubules?
A: Spermatogenesis is the production of sperm from the germinal epithelium in the primary reproductive…
Q: The neuotransmitter acetylcholine is released from presynaptic neurons in response to a nerve…
A: The neuromuscular junction plays a vital role in the transmission of signals from nerve cells to…
Q: Why is it important to cut the DNA in half before a sperm fertilizes an egg?
A: A polymer made of two chains of polynucleotide which wrap around one another to create a double…
Q: What natural and human-influenced factors may affect the following water chemistry parameters, and…
A: The health and integrity of marsh ecosystems can be significantly impacted by water chemistry…
Q: es Chromosome changes during cell cycle A cell that has just started interphase has four…
A: A series of events that take place in a cell is known as cell cycle.It happens when the cells grow…
Q: Which of the following organisms contain a pathogenicity island that encodes for type III secretion…
A: Type secretion systems (TTSS) and other virulence factors are encoded in sections of DNA called…
Q: 17. Which of these are Purines? adenine and guanine a. b. C. d. 18. Which process works against the…
A: 17. Which of these are Purines?a.adenine and guanineb. thymine, cytosine, and uracilC.thymine,…
Q: Cisplatin is an anticancer drug that exerts its effects by creating DNA adducts and damaging DNA.…
A: Cisplatin is a well-known anticancer drug widely used in the treatment of various malignancies,…
Q: A group of spherical bacteria arranged in a chain-like fashion are: Incorrect Answer: C. Spirochetes…
A: Bacteria are microscopic, prokaryotic organisms, which lack nucleus and other membrane bound…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
draw the following instructions in haworth projection
1. ADP
2. UTP
3. dTdP
4. dCMP
5. UTP
6. A polynucleotide strand in the 5'---3' direction: AUG
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 3 steps with 2 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcriptionIn a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strandImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )
- Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of cleavage indicated by arrows. Table 1 Enzyme name Recognition sequence and position of cut 5'GIAATTC3 5'G!GATCC3' 5'GIGTACC3 5'GCIGGCCGC3' 5'IGATC3' 5'GGTACIC3' 5'ALGATCT3 EcoRI ВатHI Аcс651 Notl Sau3A Kpnl BglII (i) Which restriction enzyme(s) produce blunt ends? (ii) Are there any pair of neoschizomers in the list? Explain. (iii) Are there any pair of isocaudomers in the list? Explain.What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is neededPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
- The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3'.AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. d Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 -41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5 kbp 5 kbp 5 kb 5 kbp ----The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is underlined and bolded. It also contains an origin of replication (ORI) which is found at position 30. 1 20 ORI 40 60 5'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3’ 3'...AAGCTCGAGAGCAGCAGCTСТАТGCGCTАСТАТААTGACCATTATАССССТАСGTGATAG...5' promoter 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that is complementary to the DNA in each of the following positions. Site A - binding to the top strand of the DNA at position 20 – 30 5' 3' Site B - binding to the top strand of the DNA at position 31 – 41 5' 3' 2b. Replication is occurring normally in these cells; would you expect to find a primer in both positions? Why or why not?
- In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHI
![Concepts of Biology](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)
![Concepts of Biology](https://www.bartleby.com/isbn_cover_images/9781938168116/9781938168116_smallCoverImage.gif)