Hello, i understand the question, but i only need to know which option is right, no need for explanation. thanks in advance. 13- Which statement is not correct for primer design criteria?In the length of 18-22 nt60-80% GC contentForward and reverse should have similar Tmd)The repeats of di-nucleotide formations should be avoidedBoş bırakKonceki13/40Sonraki>

A primer is a sequence of short, single-stranded DNA used in the technique of polymerase chain…

13- Which statement is not correct for primer design criteria? a) In the length of 18-22 nt b) 60-80% GC content Forward and reverse should have similar Tm d) The repeats of di-nucleotide formations should be avoided Boş bırak

13- Which statement is not correct for primer design criteria? a) In the length of 18-22 nt b) 60-80% GC content Forward and reverse should have similar Tm d) The repeats of di-nucleotide formations should be avoided Boş bırak

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Related questions

Q: Which of the following is NOT a naturally-occurring amino acid? A) B) C) D) H₂NCH-COO CH3 H₂NCH-COO…

A: The proteins are composed of twenty naturally occurring amino acids. These amino acids are alpha…

Q: 3 2. Have your partner try to move each of the joints listed in the Data Table on p. 236. For each…

A: The skeleton is the interior structure of organisms that aids in movement. It forms a framework that…

Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…

A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…

Q: Hello, I'm not following the last question here. Please help.

A: Vasopression is also called anti diuretic hormone.It is a hormone synthesized from the AVP gene as a…

Q: Where can the sagital keel be found?

A: The skull is an important and anterior component of the axial skeleton that houses the components of…

Q: Calculate AG for ATP hydrolysis in muscle at 16 °C. Use the muscle concentrations from the first…

A: Standards free energy change calculated at biochemical standards is called biochemical standard free…

Q: 6 - Restriction enzymes are used to Amplify the gene of interest D) O Ligase vector and gene of…

A: The restriction enzymes or restriction endonucleases are enzymes that cleave double-stranded DNA…

Q: 16- Which statement is not true for transportation process across cell membrane? a) O The membrane…

A: The cell membrane can be defined as the cell's outer protective covering, which allows the selective…

Q: Would you expect the glucose levels of the lactose solution to change appreciably after the addition…

A: Lactose is a disaccharide. It is made up of one monomer of glucose and one monomer of galactose. Its…

Q: 27 Which statement is true about the feature of intermediate filaments? a) Diameter is around 10 nm…

A: Anatomy is the branch of biology that deals with the study of the structure of organisms and their…

Q: 18. An un-tested (and likely dangerous) non-vaccine treatment of Covid-19. Don't do it. 19. A…

A: Introduction Vaccines Are Biological Substance That Gives Active Acquired Immunity Against A…

Q: A. As a tech in a surgical center you have been asked to ensure all instruments are clean, would the…

A: Sterilization is a technique that is used in biological and medical fields to kill unwanted…

Q: 9- Which statement is not true about membrane structure? Provides a way of separation of cell…

A: Cell is the structural and functional unit of life. Every living organism is composed of cells.…

Q: Endocrine glands are incapable of directly detecting stimuli that trigger hormone secretion There is…

A: Endocrine glands are specialized structures in the body that produce and secrete hormones directly…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: Study the following questions: 1. Define the terms: transcription, promoter, enhancer, terminator.…

A: Transcription is the process of converting genetic information from a DNA molecule into an RNA…

Q: If its possible, can you give me explanation on how to find the answers?

A: Chi-square A chi square test is a statical test to find out the similarity and different between…

Q: 4- Mitotic spindle is observed with: a) O Keratin filaments b) O Actin filaments C)O Cytoplasmic…

A: The growth and development of organisms are attributed to the unique ability of the cell to divide…

Q: In West Africa, the rainbow lizard Agama agama is primarily active during the day. However, if a…

A: Introduction :- A species is the fundamental unit of classification and taxonomic rank of an…

Q: 4. Color code the bones that are similar in each animal using color pencil or crayons. 5. Identify…

A: Certain organs will have similar functions and structure among various organisms, but with a…

Q: The amino acid sequence of a transmembrane protein has one long stretch of consecutive non-polar,…

A: The proteins that are permanently attached to the cell membrane are known as intrinsic or…

Q: A single parasympathetic response usually targets more organs & effector cells than a single…

A: The cells of the body have a unique ability to receive and respond to external signals or stimuli.…

Q: Which statement is not true about the feature of microtubules? The outer diameter is around 10 nm…

A: Cytoskeleton provides structural support to the cell. It is composed of actin, microtubules and…

Q: Why is it useful for pet car professionals and pet owners to learn about wild bird behavior? What…

A: Aggressive behaviour in birds of a certain age. Larger, sexually mature birds are more aggressive,…

Q: 12. Consider the statement "Two samples that have the same mass, volume, density, and boiling point…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: 9)(recall) During translation, what TYPE OF MOLECULE carries amino acid to the site of protein…

A: The explanation is given below for the above answers.

Q: 5- Which statement is not true for agarose gel electrophoresis? a) DNA fragments are separated based…

A: The technique which is used for the separation of DNA fragments is called agarose gel…

Q: Is this all the correct answer? Can you explain to me, please?

A: Vertebrae are the 33 unique bones that interlock with each other to form the spinal column. The…

Q: I am a little confused on this question.

A: Since we are entitled to answer up to 3 sub-parts, we’ll answer the first 3 as you have not…

Q: 18 Which statement is true for active transportation? a) There is a movement of solute against the…

A: Active transportation can be defined as the phenomenon by which substances are transported in and…

Q: Which of the following are properties of membranes? Electrically polarized Hydrophobic exterior…

A: The cell membrane is principally composed of a lipid bilayer. The membrane is selectively-permeable…

Q: This was previously rejected due to not including all parts of the question. I've added all parts in…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: I need a short and meaningful explanation for the question attached. Thanks!

A: Hydrogen bond is a type of interaction present between a hydrogen atom and an electronegative atom…

Q: 37- Which statement is not true for cell division process? a) DNA replication is done in S phase b)…

A: Cell division process. In a cell cycle there are : Two gap phases (G1 and G2) One Synthetic phase…

Q: Proto-oncogenes normally function to increase v cell division. If a mutation occurs to a…

A: Proto - oncogenes normally function to stimulating cell division . If a mutation occurs to a proto -…

Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…

A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…

Concept explainers

Violence

Violence is defined as a physical act that causes or is intended to cause harm. Violence can cause physical, emotional, or both types of harm. Violence is defined by the World Health Organization as the intended use of physical force and power that causes threat or harm against oneself, another person, or against a community or group, and has the potential to cause damage, death, mental distress, maldevelopment, or poverty.

Question

100%

Hello, i understand the question, but i only need to know which option is right, no need for explanation. thanks in advance.

13- Which statement is not correct for primer design criteria?
In the length of 18-22 nt
60-80% GC content
Forward and reverse should have similar Tm
d)
The repeats of di-nucleotide formations should be avoided
Boş bırak
Konceki
13/40
Sonraki>

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. AsnIleGlyTyrGluProSerArgAsp 2. MetPheAsnSerGluProLysCys 3. SerArgGluTyrValValThrPheGly 4. MetPheSerThrAspGluVal
Write a short discussion
First please note this is DNA-B and NOT DNA-A, also the marked answer was wrong so please choose another one
COMPLEMENTARY BASE PAIRING 1. A B. C. D. E. F OMPTON 2. A. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in the virus 77174: ATG TGTCA AAGACGGT CCTGTTTTGTA CCGTCAGGATTGA 6 GTTTTCATGCCTCCAAATCTT 10 The DNA of each species has a different base composition. Find the base composition of each species, using what you know about complement Human DNA is approximately 20%C
Please don't provide handwriting solution
TRUE OR FALSE 1. Nitrogenous bases cannot undergo electrophilic aromatic substitution.2. Cytosine forms three hydrogen bonds with guanine while Adenine forms two hydrogen bonds with Thymine in themessenger RNA.3. The glycosidic bond in nucleotides is stable in dilute ammonium hydroxide solution and dilute Sodium bicarbonatesolution.4. In gel electrophoresis, a DNA is expected to migrate towards the cathode.5. Tautomerism is a phenomenon observed in both purine and pyrimidine bases.
08 Nucleoside and nucleotide analogs are two closely related classes of anti-viral drugs that inhibit viral DNA or RNA polymerase enzymes. What is their most common mechanism of action and why are they often referred to as "chain terminators"? Edit View Insert Format Tools Table A xd0 Paragraph v They are referred as chain terminators because the sturcutre when looked at does not contain a 3 prime end 31 8 8:10 EE O 6 n
based on the pictures How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)
Ao三 Normal No Spacing Hea A- = = =国位。|鱼三、、■ Styles Paragraph Section B: Circular DNA [12] Eco01091 2698 Pfol 46 BstAPI 179 Aatil 2641 Sspl 2525 Ndel 183 Ehel 235 Pdml 2318 396 MCS lacz lac. 146 2510 Bcgl 2239 Scal 2201 236 476 493 PUC57 2710 bp BsaX 683 Sapl 707 2/6 Afll, Psel 830 Gsul 1808, Cfr101 1803. Eco311 1790. Eam11051 1718 1650 1400 rep (PMB1) BseYl 1134 Cail 1241 CAFT TR Lad l The d Mat The M 1. You have a circular plasmid (pUC57) which consisrs of 2710 bo. What would the number and length of the fragments be if you cut the plasmid wih the following essibility: Investigate 52 OO C a bla (Ap) EGO
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
1. Why do we need to check the isolated DNA for its quantity and quality? 2. The purity of DNA sample is below 1.8 A260/A280 so, where did the proteincontamination come from? Note: Cite the in-text citation and references
Please answer all parts with lots of explanation