3. The average molecular weight of human proteins is about 50,000 daltons. A few proteins are much larger, such as a muscle cell protein called titin, which has a molecular weight of 3,000,000 daltons. A) Estimate how long it will take a muscle cell to translate an MRNA coding for an average protein and one coding for titin. The average molecular mass of an amino acid is 110 daltons. Assume that the translation rate is two amino acids per second.

Q: 3b) Both a-helical 2° structure and b-pleated sheet 2° structure result from the same type of…

A: Proteins are the unbranched polymer of amino acids. They have four different level of structural…

Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…

A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: 2.3 Many endosomes become acidic because they have transporters in their membranes that pump H+ ions…

A: An Eukaryotic cell consists of many small organelles .Each and every organelle is specified for…

Q: 7. You are studying the folding and stability of a bacterial nuclease. Upon exposing the enzyme to 8…

A: Introduction :- Bacterial nuclease is an enzyme that hydrolyzes the phosphodiester bonds of nucleic…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 46. The SH2 protein domain has 2 binding sites: one for ________ and one for _________. A.…

A: SH2 domains are protein modules which take part in the tyrosine kinase signaling pathways. These…

Q: ead Cells have oligosaccharides displayed on their cell surface that are important for cell-cell…

A: The lipid bilayer (or phospholipid bilayer) is a thin polar membrane made of two layers of lipid…

Q: The primary protein structure is shown in Figure 9-3(a).Where in the mRNA (near the 5′or 3′end)…

A: The proteins are assembled as amino acid sequences, joined together with bonds, and folded into…

Q: 81. You have used the primary amino acid sequence of a newly identified protein (of unknown…

A: This question is about hydropathy plot . The hydropathy plot displays the hydrophobic and…

Q: 7. A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to gel…

A: As we know that the sodium dodecyl (SDS) sulfate is considered as the denaturing agent, which helps…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: The figure above shows some of the more common modifications, such as phosphorylation (1),…

A: Phosphorylation- Protein phosphorylation occurs in post-translational modification. Here phosphate…

Q: a. Approximately how many amino acids are present in a 400 kDa protein. (show work) b. How many…

A: Gel electrophoresis Gel electrophoresis is a technique used for the separation of proteins based on…

Q: 1. You order two primers from a company that synthesizes oligonucleotides. The primers have the…

A: Primers are short stretches of nucleotides that are used to initiate the synthesis of nucleic acids.…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. a) Describe the role…

A: Translation is the process of synthesizing a protein from the mRNA. The genetic information in the…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: You are working on a protein with the following sequence in an area of interest.…

A: Proteins are made up of different amino acids. Some amino acids have ionizable side chains. All…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this…

A: pI of protein is directly proportional to the pKa of amino acids.

Q: 23. Contrast the “functional” size of the four major classes of biomolecules.  Background: Up…

A: Carbohydrates, proteins, lipids, and nucleic acids are the four major biomolecules. Carbohydrates…

Q: Val (V) Ala (A) Arg (R) Ser (S) Lys (K) Start Stop A с U G Using the codon wheel below, identify…

A: Amino acids are organic molecules that are the building blocks of proteins. They are composed of a…

Q: Lactose Permease is roughly 45 kDa in size. Approximately how many nucleotides in length is the…

A: Lactose permease is a membrane protein serving as a transport system for lactose into the E. coli…

Q: 6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group…

A: Protein modification - Major types of proteins modifications are phosphorylation, acetylation and…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.