15. Given the following (the start of a very long MRNA sequence), Val GUA GCA GCG GAA GAG Glu GA GUG GGG 5' CCGUAAGAUGGCGAACACAUUGUCAUCCAAUGC....... 3' what amino acid sequence would be produced in a cell?

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…

A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…

A: Given: DNA sequence

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon  It is the three consecutive sequence of a mRNA that code for amino acid.

Q: If an mRNA sequence begins 5'-GGACGUAGA...-3', which of the following sequences would continue that…

A: Hairpin loop is formed when the two mRNA strands have complementary sequences at their ends that's…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Use the sequence from the pre-mRNA shown below to answer the following question.…

A: Introduction :  The GU (5' splice site) and AG (3' splice site) recognise splice sites, signalling…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’

A: The single strand of the RNA molecule, which consists of a gene sequence and carries the message…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: A piece of mRNA is moving along the ribosome.  Which amino acid would bind if the mRNA read....…

A: The process of protein synthesis is called translation. It occurs on ribosomes bound to mRNA in the…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…

A: The process of copying the information in a strand of DNA to produce an mRNA is called…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: in the human beta-globin, two introns are spliced out in order to produce the mature mRN

A: The gene regulation can be exercised at different levels where DNA can be packed tightly or loosely…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given…

A: RNA strnad given = 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' (i) DNA strand from which this mRNA is…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 46.Describe briefly the functions of the three types of RNA (tRNA, mRNA and rRNA) in protein…

A: Transcription the process of making RNA copy from DNA. Translation is the process of making proteins…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: hange the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: What mRNA base sequences are complementary to the following DNA template sequences? Be sure to label…

A: The process by which the mRNA is transcribed from the parental DNA is known as the process of…

Q: In Figure 9-12, is the terminal amino acid emerging fromthe ribosome encoded by the 5′or 3′end of…

A: Translation is a process by which amino acids are linked together by peptide bonds thereby forming…

Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ -...…

A: The mRNA (messenger ribonucleic acid) is a messenger molecule produced through the process of…

Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3

A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.