. In an effort to determine the location of an operator sitefor a negatively regulated gene, you have made a seriesof deletions within the regulatory region. The extent ofeach deletion is shown by the line underneath the sequence, and the resulting expression from the operon(i = inducible; c = constitutive; − = no expression) isalso indicated.... GGAT C T T AGCCGGCTAACATGATAAATATAA......C C T AGAATCGGCCGA TTGTA C T A TTT ATAT T ...1 i2 –3 c4 –5 ca. What can you conclude from these data about thelocation of the operator site?b. Why do you think deletions 2 and 4 show no expression of the gene?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
. In an effort to determine the location of an operator site
for a negatively regulated gene, you have made a series
of deletions within the regulatory region. The extent of
each deletion is shown by the line underneath the sequence, and the resulting expression from the operon
(i = inducible; c = constitutive; − = no expression) is
also indicated.
... GGAT C T T AGCCGGCTAACATGATAAATATAA
...
...
C C T AGAATCGGCCGA TTGTA C T A TTT ATAT T ...
1 i
2 –
3 c
4 –
5 c
a. What can you conclude from these data about the
location of the operator site?
b. Why do you think deletions 2 and 4 show no expression of the gene?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
