Nutrition: Concepts and Controversies
13th Edition
ISBN: 9781133603184
Author: Frances Sizer, Ellie Whitney
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 4, Problem 2SC
The polysaccharide that helps form the supporting structures of plants is
- cellulose
- maltose
- glycogen
- sucrose
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Which of the followings is not a structural polysaccharide?
O Starch
O Peptidoglycans
O Cellulose
O Chitin
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes:
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’
5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’
Which strand is the template strand?
Name two common polysaccharides made by plants. Are they also made of glucose? Can we digest both of them, and why or why not?
Chapter 4 Solutions
Nutrition: Concepts and Controversies
Additional Science Textbook Solutions
Find more solutions based on key concepts
A worker accidentally ingested an unknown amount of UCo activity. His body burden was measured by whole-body co...
Introduction To Health Physics
Why are mutants used as test organisms in the Ames test?
Laboratory Experiments in Microbiology (11th Edition)
An aluminum calorimeter with a mass of 100 g contains 250 g of water. The calorimeter and water are in thermal ...
Physics for Scientists and Engineers, Technology Update (No access codes included)
Why is physics the most basic science?
Conceptual Physics: The High School Physics Program
Determine the de Brogue wavelength of a. an electron moving at 1/10 the speed of light. b. a 400 g Frisbee movi...
Inorganic Chemistry
2. Why shouldn’t you work in a laboratory by yourself?
The Organic Chem Lab Survival Manual: A Student's Guide to Techniques
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, health-nutrition and related others by exploring similar questions and additional content below.Similar questions
- An example of a monosaccharide is ________. a. fructose b. glucose c. galactose d. all of the abovearrow_forwardWhich polysaccharide is usually found in the cell walls of fungi? a. starch b. glycogen c. chitin d. cellulosearrow_forwardWhich of the following is not a complex conjugated carbohydrate? O peptidoglycan O glycoprotein O proteoglycan O oligosaccharide O lipopolysaccharidearrow_forward
- Which of the following is a property of both D-altrose and D-talose O They are found in sucrose. O They are major constituents of nucleic acids. O They are reducing sugars. O They are epimers of D-allose.arrow_forwardWhat property is exhibited by proteins which allows them to absorb large quantities of water? saponification imbibition deamination decarboxylationarrow_forwardWhich of the following is false about cellulose?arrow_forward
- Casein is a protein found in milk. The role of casein in milk is to be a source of amino acids. Casein is therefore a amino acid storage molecule. Which carbohydrate molecule has an analogous role to that of casein? cellulose glycosylphosphatidyl inositol hyaluronic acid glycogernarrow_forwardCH2O is formula of carbohydrate, and Lactose and sucrose is a monosaccharide true False Some proteins have mechanical functions such as actin and myosin in the cytoskeleton true Falsearrow_forwardIdentify the monosaccharides that are processed in glycolysis other than glucose. O Ribose V Galactose V Mannose Amylose O Fructosearrow_forward
- Which of the following statements about sugar polymers and glycosaminoglycans is/are true? Glucosamine, an amino sugar, would be positively charged physiologically unless it is part of an amide bond. Chitin is a homopolymer of GlcNac in beta 1--> 4 linkages. Amylose is a homopolymer of glucose containing alpha 1--> 6 linkages. Amylopectin in a non-reducing sugar polymer consisting solely of glucose monomers. Agarose is a highly charged sugar polymer used in electrophoresis. A core of hyaluronan protein is linked to an aggrecan polysaccharide in the extracellular matrix around joints and tendons. Mucins are secreted proteins that contain branched oligosaccharides linked to serine residues. None of the options shown is true. The glycosaminoglycan "hyaluronic acid" would carry more negative charge overall when compared to a polymer of "chondroitin" of the same length. Please answer very soon will give rating surely Complete Answer neededarrow_forwardIf sucrase is the enzyme that binds with sucrose, what is the name for the enzyme that binds withthe disaccharide lactose.arrow_forwardThe connection between these wordsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
What is Metabolism?; Author: Stated Clearly;https://www.youtube.com/watch?v=nRq6N5NGD1U;License: Standard youtube license