
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17.3, Problem 1CSC
It is not surprising that the forests of New Guinea are home to a variety of distinctive species like the miniature frog Paedophryne amauensis. New Guinea is, after all, an island. It is likely that in the past, populations colonized the island and became genetically isolated from mainland populations, thereby initiating the process of
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 17 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 17.1 - The tiny frog paedophryne amauensis was discovered...Ch. 17.1 - describe how biologists define species and explain...Ch. 17.1 - One way to determine the number of species on...Ch. 17.1 - Prob. 1TCCh. 17.1 - describe the biological species concept and...Ch. 17.1 - list some reasons why it can be hard to tell...Ch. 17.2 - describe the main types of premating and...Ch. 17.2 - provide examples of each type of mechanism?Ch. 17.3 - It is not surprising that the forests of New...Ch. 17.3 - describe the two general steps that are required...
Ch. 17.3 - Make a list of events or processes that could...Ch. 17.3 - One possible explanation for the distinctive...Ch. 17.3 - explain the difference between allopatric and...Ch. 17.3 - How might conservation scientists use the map...Ch. 17.3 - explain adaptive radiation and describe the...Ch. 17.3 - Prob. 3TCCh. 17.3 - interpret an evolutionary tree diagram?Ch. 17.3 - Prob. 4TCCh. 17.4 - Prob. 1CTCh. 17.4 - describe the main causes of extinction?Ch. 17.4 - If specialization puts a species at risk for...Ch. 17.4 - Prob. 2CYLCh. 17.4 - Given that genetic isolation is the first step in...Ch. 17 - It is difficult to perform experiments that test...Ch. 17 - A species is a group of ________ that evolves...Ch. 17 - The biological species concept is difficult or...Ch. 17 - Define the following terms: species, speciation,...Ch. 17 - Fill in the following with the appropriate...Ch. 17 - Which of the following does not describe a...Ch. 17 - Many of the oak tree species in central and...Ch. 17 - Formation of a new species occurs when two...Ch. 17 - All instances of speciation require a. genetic...Ch. 17 - Review the material on the possibility of...Ch. 17 - The process by which many new species arise in a...Ch. 17 - Analysis of Rhagoletis fly populations in North...Ch. 17 - A drug called colchicine prevents cell division...Ch. 17 - A species may be at higher risk of extinction if...Ch. 17 - In the initial phase of allopatric speciation,...Ch. 17 - What are the two major types of reproductive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Evidence for Evolution - Biogeography; Author: Viced Rhino;https://www.youtube.com/watch?v=304wIG6H11E;License: Standard YouTube License, CC-BY