
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.4, Problem 1CT
Summary Introduction
To determine:
Who should decide which species will live and which will die.
Introduction:
Mass extinction is an event that is involved in the extinction of very large populations of biodiversity present on the Earth. It occurs when the rate of extinction is more than the rate of
Summary Introduction
To determine:
The criteria decide which species will live and which will die are based on.
Introduction:
The endangered species is a species whose number has fallen to a critically low level and are likely facing the threat of extinction. The extinction of the species occurs due to loss of habitat and due to loss of genetic variation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 17 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 17.1 - The tiny frog paedophryne amauensis was discovered...Ch. 17.1 - describe how biologists define species and explain...Ch. 17.1 - One way to determine the number of species on...Ch. 17.1 - Prob. 1TCCh. 17.1 - describe the biological species concept and...Ch. 17.1 - list some reasons why it can be hard to tell...Ch. 17.2 - describe the main types of premating and...Ch. 17.2 - provide examples of each type of mechanism?Ch. 17.3 - It is not surprising that the forests of New...Ch. 17.3 - describe the two general steps that are required...
Ch. 17.3 - Make a list of events or processes that could...Ch. 17.3 - One possible explanation for the distinctive...Ch. 17.3 - explain the difference between allopatric and...Ch. 17.3 - How might conservation scientists use the map...Ch. 17.3 - explain adaptive radiation and describe the...Ch. 17.3 - Prob. 3TCCh. 17.3 - interpret an evolutionary tree diagram?Ch. 17.3 - Prob. 4TCCh. 17.4 - Prob. 1CTCh. 17.4 - describe the main causes of extinction?Ch. 17.4 - If specialization puts a species at risk for...Ch. 17.4 - Prob. 2CYLCh. 17.4 - Given that genetic isolation is the first step in...Ch. 17 - It is difficult to perform experiments that test...Ch. 17 - A species is a group of ________ that evolves...Ch. 17 - The biological species concept is difficult or...Ch. 17 - Define the following terms: species, speciation,...Ch. 17 - Fill in the following with the appropriate...Ch. 17 - Which of the following does not describe a...Ch. 17 - Many of the oak tree species in central and...Ch. 17 - Formation of a new species occurs when two...Ch. 17 - All instances of speciation require a. genetic...Ch. 17 - Review the material on the possibility of...Ch. 17 - The process by which many new species arise in a...Ch. 17 - Analysis of Rhagoletis fly populations in North...Ch. 17 - A drug called colchicine prevents cell division...Ch. 17 - A species may be at higher risk of extinction if...Ch. 17 - In the initial phase of allopatric speciation,...Ch. 17 - What are the two major types of reproductive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning