Answered: Biology You’re going to make 1% (w/v)…

Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter13: Dimensional Analysis/units Conversion

Section: Chapter Questions

Problem 1.3P

See similar textbooks

Related questions

Q: Find the dental formula and enter it in the following format: I3/3 C1/1 P4/4 M2/3 = 42 (this is not…

A: Answer well explained above

Q: Suppose that the population from question #1 (data is in table below) is experiencing inbreeding…

Q: 8. Most reactions of anaerobic respiration are similar to a. aerobic respiration b. photosynthesis…

A: Anaerobic respiration refers to the process by which cells produce energy (ATP) without oxygen as…

Q: a) The word “cloning” refers to making copies of bacteria making cloned sheep or another eukaryotic…

A: Cloning refers to the process of creating an exact genetic replica of a cell, tissue, or organism.…

Q: Action to resolve or at least mitigate Zomedica's TRUFORMA current and potential negative impacts on…

A: Detailed explanation: 1. Actions to Resolve or Mitigate Current and Potential Negative Impacts, and…

Q: OOO O The table shows the utility Jordan receives at various income levels, but they do not know…

A: step-by-step.1. Calculate Expected IncomeExpected income is the weighted average of possible…

Q: Our body-water-compartments can be separated into three distinct andfundamental regions. Which of…

A: Our body is made mostly of water and this water is divided into 3 main compartments. Let's discuss…

Q: What are some drug interactions of heparin?

A: Heparin is a widely used anticoagulant medication that plays a critical role in the prevention and…

Q: The following diagram depicts the topology of a multipass transmembrane protein in the endoplasmic…

A: In the topology of a multipass transmembrane protein within the endoplasmic reticulum (ER) membrane,…

Q: Compare and contrast MHC 1 and MHC 2. Describe two way they are different and two ways they similar…

A: Approach to Solving the Question The question requires comparing and contrasting MHC Class I and MHC…

Q: In another question, you explained the classical monocot leaf pattern. However, in this life…

A: Both Poa pratensis (Kentucky bluegrass) and Zea mays (maize or corn) belong to the angiosperm group…

Q: What enzyme is can break down some but not all monoamines?

A: AnswerMonoamine Oxidase (MAO) is an enzyme that can break down some monoamines but not all of them.…

Q: 9 S es Read the section "Investigating Life: In (Extremely) Cold Blood." Then, drag and drop the…

A: This concept map explains the unique blood characteristics of icefishes, focusing on their genetic…

Q: Question 4 1 pts Which of the following would be most helpful for demonstrating alternative splicing…

A: Alternative splicing is a process that allows a single gene to code for multiple proteins. This is…

Q: You will be building a double-stranded DNA molecule, representing a short (20 base) sequence that…

A: Approach to solving the question:I'll show you how to use my graphics to visualize the DNA…

Q: QUESTION 13 A cow recently fought off the tetanus bacterium. A serum of its antibodies was injected…

A: There are four types of immunity: natural passive immunity, artificial passive immunity, natural…

Q: Which of the following is not one of the bones of the cranium?A. frontalB. occipitalC. temporalD.…

A: The cranium is the part of the skull that encloses the brain. It is made up of several bones,…

Q: please help thank you

A: The protonema in the diagram is labeled as B. We can identify this structure as the protonema…

Q: Which ONE of the following is FALSE regarding haemoglobin? It has two alpha subunits…

A: Haemoglobin is a protein molecule in the red blood cells that carries oxygen from the lungs to the…

Q: questions about GMOs (genetically modified organisms): (1) Explain the agrobacterium-based method…

A: Step 1: Answer -11) Explain the agrobacterium-based method for GMO development.The answer of this…

Q: A farmer has noticed that his soybean plants produce more beans in some years than others. He claims…

A: Question Addressing the Farmer's ProblemThe farmer's inquiry can be articulated as follows:What is…

Q: a. Which drug is the most potent? a,b,c,d,e b. Which drug has the highest efficacy?

A: To answer the two questions in detail, let's analyze the provided dose-response graph. Understanding…

Q: Which of the following is the process that is "capable of destroying all forms of microbial life"?…

A: The question is asking us to identify the process that can destroy all forms of microbial life.…

Q: Indicate whether each of the following descriptions better applies to COPI- (1), COPII- (2), or…

A: Here's a step-by-step explanation for why each vesicle type matches the descriptions:Transport from…

Q: Give me detailed Solution. Don't give Ai generated solution

A: Transcription is a process where the DNA sequence is used as a template to synthesize a…

Q: A scientist uses transduction to map genes in a strain of E. coli. For this experiment, the donor…

A: Genetic mapping, a cornerstone technique in molecular biology, allows researchers to delineate the…

Q: can you explain and write out the process needed to answer this question. thanks!

Q: a) Name the structural layer just inside of the envelope. b) Spike (S) proteins bind to…

A: The structural layer just inside of the envelope of a virus is called the capsid. The capsid is a…

Q: None

A: Step 1:The molar mass of ammonia (NH₃) is 17.031 g/mol.The concentration is 494 mg/m³ = 0.494…

Q: The large muscle protein that essentially “anchors” the thin-filaments to theCell membrane and…

A: In the muscle cells, there are several types of proteins that play different roles. Actin and myosin…

Q: Abscission Zone: The Abscission Zone forms at the It facilitates leaves to The Abscission Zone is…

A: Your inquiries include a wide range of subjects, such as the anatomy and physiology of plants as…

Q: what is an intermittent water course and what kind of fish habitat it would provide

A: An intermittent water course is a type of water body that does not flow continuously. It is also…

Q: Fitness 6. The primary theory to explain the evolution of cooperation among relatives is Kin…

A: 7. In vampire bats, group members that have fed successfully sometimes feed regurgitated blood to…

Q: a) When does the process of X inactivation occur? 1. During the development of the egg 2. During…

A: X inactivation is a process by which one of the two copies of the X chromosome present in female…

Q: What is the rate-limiting-step for serotonin synthesis?

A: First, let's briefly describe what "rate-limiting step" means. In this context, particularly in…

Q: QUESTION 19 Which of the following is not a sign of inflammation? O Swelling O Heat Diapedesis…

A: Inflammation is a biological response of body tissues to harmful stimuli, such as pathogens, damaged…

Q: Hello, Can you please help me with an overview of Microbemia. A description of the causative agent,…

A: Key references: Morris, A. C., & DeVoe, C. (2016). Bacteremia and sepsis: Understanding the…

Q: a)At what wavelength (nm) on a spectrometer can this color be quantified? b)…

A: a) At what wavelength (nm) on a spectrometer can this color be quantified?In most colorimetric…

Q: New nucleotides are added at an estimated rate of about 42-54 nucleotides per second in bacteria…

A: DNA replication is a biological process that occurs in all living organisms and is the basis for…

Q: Why do we test the deep tendon reflexes? Why is obstetrics a field that does a lot of deep tendon…

A: Why Do We Test Deep Tendon Reflexes? Deep tendon reflex (DTR) testing is performed to assess the…

Q: Based on the filled out paper (the one with tables), how do I fill out the second paper? Please…

A: I'll provide transcription and translation steps for each table in the worksheet. Note that each…

Q: While investigating an unidentified motor protein, you discover that it has two heads that bind to…

A: (A) Myosin I - Incorrect: Myosin I typically has a single head that interacts with actin, so the…

Q: QUESTION 16 Which of the following granulocyte is associated with helminth infections? O Basophils O…

A: The question is asking us to identify which type of granulocyte is associated with helminth…

Q: We will be starting a group project next week where you and your group will research and ultimately…

A: Detailed Explanation: SARS-CoV-2 (COVID-19)SARS-CoV-2 is the virus responsible for the COVID-19…

Q: Which ONE of the following is FALSE regarding haemoglobin? It has two alpha subunits…

A: Haemoglobin is a protein molecule in the red blood cells that carries oxygen from the lungs to the…

Q: Biopharmaceutics and Pharmacokinetics:Two-Compartment Model Zero-Order Absorption Questions SHOW ALL…

A: Approach to solving the question: Detailed explanation:To solve the given problem, we need to use…

Q: Imagine that you are part of a research team that specializes in diagnosing disorders associated…

A: The diagnostic analysis of a two-day-old newborn male patient with systemic symptoms highlights the…

Q: identify the cell shown

A: The correct answer is heterocyst, and here's why, along with explanations for why the other options…

Q: San Andreas Transform Boundary Plate Motion The geologic map below of southern California shows the…

A: Step 1: Identify displacement over time using geological features like volcanic features Step 2:…

Q: Given the following sequence on the coding strand of prokaryotic DNA, provide all of the following…

A: Answer:DNA Template Strand: 3' TACGCTGATCCAAACGGCCTACCTAC 5'mRNA: 5'…

Question

Biology

You’re going to make 1% (w/v) agarose gel in 0.5X
TBE buffer 100 ml. How much agarose are you going
to add to 100 ml of buffer? The volume of agarose
is negligible.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Compare the thiamin density of 3 ounces of lean T-bone steak (174 kcalories, 0.09 milligrams thiamin) with cup of fresh cooked broccoli (27 kcalories, 0.05 milligrams thiamin).
MATHEMATICAL The buffer needed for Question 35 can also be prepared using crystalline NaH2PO4 and a solution of 1.0 M NaOH. How would you do this?
Calculate the carbohydrate concentration of a sports drink that contains 20 grams of carbohydrate per serving (240 milliliters).
Which Is â€œBetter: NMR or MS? Compare and contrast mass spectrometry and NMR. in terms of their potential advantages and disadvantages for metabolomic analysis.
MATHEMATICAL Calculate the isoelectric point of each of the following amino acids: glutamic acid, serine, histidine, lysine, tyro- sine, and arginine.
MATHEMATICAL A catalog in the lab has a recipe for preparing 1 L of a TRIS buffer at 0.0500 M and with pH 8.0: dissolve 2.02 g of TRIS (free base, MW=121.1 g/mol) and 5.25 g of TRIS hydrochloride (the acidic form, MW=157.6 g/mol) in a total volume of 1 L. Verify that this recipe is correct.
RECALL The accompanying figure is from an electrophoresis experiment using SDSPAGE. The left lane has the following standards: bovine serum albumin (MW 66,000), ovalbumin (MW 45,000), glyceraldehyde 3-phosphate dehydrogenase (MW 36,000), carbonic anhydrase (MW 24,000), and trypsinogen (MW 20,000). The right lane is an unknown. Calculate the MW of the unknown.
MATHEMATICAL Sketch a titration curve for aspartic acid, and indicate the pKa values of all titratable groups. Also indicate the pH range in which the conjugate acid-base pair +1 Asp and 0 Asp will act as a buffer.
The synthetic process by which monomers are covalently linked is (a) hydrolysis (b) isomerization (c) condensation (d) glycosidic linkage (e) ester linkage
MATHEMATICAL An organic chemist is generally happy with 95% yields. If you synthesized a polypeptide and realized a 95% yield with each amino acid residue added, what would be your overall yield after adding 10 residues (to the first amino acid)? After adding 50 residues? After 100 residues? Would these low yields be biochemically satisfactory? How are low yields avoided, biochemically?
REFECT AND APPLY Write equations to show the ionic dissociation reactions of the following amino acids: aspartic acid, valine, histidine, serine, and lysine.
MATHEMATICAL Calculate the hydrogen ion concentration, [H+], for each of the following materials: (a) Blood plasma, pH 7.4 (b) Orange juice, pH 3.5 (c) Human urine, pH 6.2 (d) Household ammonia, pH 11.5 (e) Gastric juice, pH 1.8