Transcribe the given DNA sequences to mRNA. a) DNA: 5'-GATCCGC-3' mRNA: 3'- b) DNA: 5'-AATCGCATT-3' mRNA: 3'- - 5' -5' c) DNA: 5'-AGCAGTTACCA-3' mRNA: 3'- -5' d) DNA: 5'-ATCGCTAATCCGCGC-3' mRNA: 3'- -5'

Transcribe the given DNA sequences to mRNA. a) DNA: 5'-GATCCGC-3' mRNA: 3'- b) DNA: 5'-AATCGCATT-3' mRNA: 3'- - 5' -5' c) DNA: 5'-AGCAGTTACCA-3' mRNA: 3'- -5' d) DNA: 5'-ATCGCTAATCCGCGC-3' mRNA: 3'- -5'

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: How does the number of genes in the microbiome compare to the number in the human or the rice plant?…

A: 1. Number of Genes in the Microbiome vs. Human and Rice Genome: The microbiome, particularly the gut…

Q: Hardy Weinberg problem

A: Given Information:Total population = 2,740 snapdragon plantsRed-flowered (RR) = 966White-flowered…

Q: Show work. don't give Ai generated solution .give correct solution

A: Increased free PSAIn cases of prostate cancer, the total PSA (both free and bound forms) generally…

Q: Answer the following using Branch Diagrams using a set of completely made-up human characteristics…

A: We will represent each trait as a separate branch, and each branch will split based on the dominant…

Q: What are Major development milestones that changed Zomedica's TRUFORMA technology and its impacts…

A: Zomedica's TRUFORMA is an advanced diagnostic platform for veterinary use. The major development…

Q: Why is it important to know how much is biodegradableand non-biodegradable?

A: Biodegradable materials are those that can be broken down naturally by microorganisms into simpler…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options.

A: The answer is B. Inhibition of CDK2.Myc is a proto-oncogene that plays a central role in regulating…

Q: Please draw them and folllow direction A) describe what you see, and (b) give examples of locations…

A: A) picture of each epithelial tissue:1) Simple squamous epithelium:2) Simple cuboidal epithelium:3)…

Q: In a certain plant, the genes for flower color and pollen shape are linked. In fe color, Purple (P)…

A: Explanation; a. Phenotypes of the Recombinant-Type Offspring In genetic linkage, recombinant…

Q: Tarzan and Jane are both normal, but their first child is affected with heroism, an autosomal…

A: First, we need to understand the nature of the trait. Heroism is described as an autosomal recessive…

Q: Don't use Ai and chatgpt. Answer in step by step with explanation

A: Hypercholesterolemia is a condition caused by an interaction of genetic factors, sedentary…

Q: What causes the most frequent symptom experienced by someone infected with S.pneumoniae? A)…

A: Why the other options are less likely to be the primary cause of the most frequent symptom in…

Q: you wrote a reflection encompassing the following two questions: •How does a deeper understanding…

A: Photosynthesis and cellular respiration are fundamental biological processes that sustain life on…

Q: In another question, you explained the classical monocot leaf pattern. However, in this life…

A: Both Poa pratensis (Kentucky bluegrass) and Zea mays (maize or corn) belong to the angiosperm group…

Q: Don't use Ai and chatgpt. Answer in step by step with explanation.

A: Understanding the Components of the Problem1. Mean Height of Giraffes: The current mean height of…

Q: Describe the indicators used to measure the nutritional status of children in the Caribbean.

A: The nutritional status of children is a critical indicator of a community's overall health. In the…

Q: Don't use Ai and chatgpt. Answer in step by step with explanation.

A: Dear student, I have provided an answer and explanation to your assignment. Please pay close…

Q: Can you please help me to answer this about Salmonella? Identify whether it is a gram-positive or…

A: References:https://www.ncbi.nlm.nih.gov/books/NBK562156/https://www.ncbi.nlm.nih.gov/pmc/articles/PM…

Q: True or Falso: in meiosis the intermediate cells formed after meiosis I are haploid going into…

A: Meiosis is a type of cell division that results in four daughter cells each with half the number of…

Q: Which of the following bonds demonstrates electronegativity due to an unequal sharing of electrons…

A: Step 1:Option 2 and 4 are correct Step 2: Step 3: Step 4:

Q: Would an antibiotic that targets cell wall synthesis have more or less toxic side effects than one…

A: An antibiotic that targets cell wall synthesis is generally less toxic to human cells than one that…

Q: How may the abuse of drugs relate to the plasticity of the brain?

A: Brain plasticity, also known as neuroplasticity, refers to the brain's ability to change and adapt…

Q: Briefly outline the ancestry of animals from the free-living, unicellular Choanoflagellates to the…

A: The evolution of animals from unicellular organisms, specifically choanoflagellates, to the diverse…

Q: 11.32 For the pedigrees A and B, indicate whether the trait involved in each case could be recessive…

Q: Una cassa di 3 kg si trova all' altezza di 4m. Calcola la sua energia potenziale (in joule).

A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…

Q: List 3 types of carbohydrates. Give an example of each type and describe its function in a…

A: Monosaccharides are the simplest form of carbohydrates and cannot be further hydrolyzed to smaller…

Q: For the behavior of a neuron when it is NOT being stimulated describe what is happens to the ions.

A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology

Q: Don't use Ai and chatgpt. Answer in step by step with explanation

A: Let's examine the justifications for each claim in more detail: 1. **A gene that codes for a protein…

Q: Which of the following sequencing techniques can identify down to the strain level? O Multilocus…

A: The correct answer is "All of the above", but let's break down each sequencing technique to…

Q: A person with blood type O and heterozygous for the Bombay phenotype mutation marries a person with…

A: The Bombay phenotype is a rare variant of the ABO blood group system. People with this phenotype do…

Q: Species or F1 hybrid Root tip chromosome number The following table presents chromosome data on four…

A: Photo credits.

Q: DNA Fingerprinting Experiment Daughter Mother Possible Fathers Horse Horse 1 2 3 4 Which stallion…

A: DNA fingerprinting involves analyzing the DNA bands of the mother, the daughter, and potential…

Q: help answer the last question

A: To provide a more detailed explanation of the conclusions drawn from the PCR and restriction…

Q: 1. The mature transcripts that represent normally spliced products 2. The mature manuscript that…

A: 1. Mature transcripts representing normally spliced products are those where introns are removed and…

Q: Hello, Can you please help me with the next question? How does the rabies virus enter the body and…

A: Rabies is primarily transmitted through the bites of infected animals, including dogs and bats. The…

Q: Hello, Can you please help me to decribe "Poliomyelitis" please? The pathogen associated with the…

A: Poliomyelitis (Polio)Poliomyelitis, commonly called polio, is a highly infectious viral disease…

Q: Answer in step by step with explanation. Don't use Ai. Answer in all options.

A: The sole biological experiment on the Viking landers that produced a favorable outcome was the…

Q: Please help answer

A: In competitive inhibition, a molecule that is structurally very similar to the substrate stops the…

Q: Hello, Can you please help me to summarize ]the major points of the article including the importance…

A: The human microbiota is a collection of microorganisms that live in and on the human body. It is…

Q: QUESTION 7 The three parameters in steam sterilization in an autoclave are... Oa. Steam under…

A: The correct answer is a. Steam under pressure, time, temperature. These are the three critical…

Q: Does this source pass the CRAPP test? How so? Farias PM, Marcelino G, Santana LF, de Almeida EB,…

A: Applying the CRAPP test—Currency, Relevance, Authority, Accuracy, and Purpose—to evaluate the…

Q: Biology Questions The questions are showed in the attached pictures

A: Image 2 QuestionsLabeling the Kidney Diagram:Renal Cortex: The outer region of the kidney, where…

Q: Figure 2-1 RNA polymerase FO S 4 0000 TpE TrpD trpC tr8 trp synthetic genes Next primer التالي…

A: In the figure, the part indicated by the symbol S represents the operator region of the trp operon…

Q: ми или

A: Key Observations:Periodicity: The pattern repeats regularly, indicating a periodic…

Q: How can we connect the nutmeg to osmosis concepts from earlier in the class? why was GG having…

A: 1. Osmosis, Seizures, and Nutmeg: A Complex Interaction • The toxicity of nutmeg: The active…

Q: improvement in food resources notes

A: Improvements in Food Resources 1. Agricultural InnovationsGenetic Engineering: Development of…

Q: Instructions: Create a collage that illustrates the historical development of Molecular Biology.…

A: The collage I proposed is designed to visually represent the historical development of molecular…

Q: 1. Both natural selection and genetic drift can reduce heterozygosity (H). At what allele frequency…

A: Understanding Heterozygosity and its Loss Due to Genetic Drift and Selection1. Maximum…

Q: prototrophic HFR strain and an Streptomycin Resistant gly- tyr- ala- pro- ser- auxotrophic strain.…

A: Based on the data provided in the table and the multiple-choice questions, here are the answers to…

Q: Assignment #1: Build a phylogenetic tree (showing all the steps) based on the morphological…

A: Detailed and Neat Response to Plant Classification Questions:1. Synapomorphies:• Leaf margin unlobed…

Question

Give me detailed Solution. Don't give Ai generated solution

Transcribe the given DNA sequences to mRNA.
a) DNA: 5'-GATCCGC-3'
mRNA: 3'-
b) DNA: 5'-AATCGCATT-3'
mRNA: 3'-
- 5'
-5'
c) DNA: 5'-AGCAGTTACCA-3'
mRNA: 3'-
-5'
d) DNA: 5'-ATCGCTAATCCGCGC-3'
mRNA: 3'-
-5'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-C
After sequencing a segment of DNA you identify the following sequence: 5' TCTTAGCGCATTGGACATGTAAGGCACGT 3' A.) What is the complementary sequence? B.) If this is the beginning of a gene, which is the coding strand? C.) What would the mRNA sequence be? D.) What would be the protein sequence? E.) If a base substitution occurred converting the bold nucleotide to an 'A' what effect would that have on the protein sequence and function?
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.
A given coding strand sequence in a Eukaryote is as follows 5'GGGAATATAA GACCGATGGA GGGTACAG CCCTATCAC GATACGCAGG ATAGCAGCA 3" a) Mark the promoter in blue and transcribe from the G after the promoter. b) Translate the mRNA made c) The mRNA made by the cell was 10 nucleotides shorter than what you have made. What could have happened? d) EXTRA practice: A particular triplet of bases in the coding strand of DNA is 5'GAC 3'. What is the amino acid for this codon and will be the anticodon on the tRNA that binds the mRNA codon?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU
The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome: Choose the sequence that would correspond to that mRNA. A: 3’ – TACGGAACG – 5’ B) 3’ – AUGCCUUGC – 5’ C) 5’ – AUGCCUUGC – 3’ D) 3’ – UACGGAACG – 5’ E) 5’ – UACGGAACG – 3’
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’