Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 8P
What can we conclude about a mutational event thatrenders
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
why would a mutation complex 1 usually not result in immediate death ? And while blocking complex IV can result in immediate death ?
Why are mutations in the INK4 locus so dangerous?
When 1 million cells of a culture of haploid yeastcarrying a met− auxotrophic mutation were plated onpetri plates lacking methionine (Met), five coloniesgrew. You would expect cells in which the originalmet− mutation was reversed (by a base change back tothe original sequence) would grow on the media lackingmethionine, but some of these apparent reversions couldbe due to a mutation in a different gene that somehowsuppresses the original met− mutations. How wouldyou be able to determine if the mutations in your fivecolonies were due either to a precise reversion of theoriginal met− mutation or to the generation of a suppressor mutation in a gene on another chromosome?
Chapter 13 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 13 - Prob. 1PCh. 13 - For one set of chromosomes carried by a triploid...Ch. 13 - 10.8 If the haploid number for a plant species is...Ch. 13 - From the following list, identify the types...Ch. 13 - Mating between a male donkey (2n=64) and a female...Ch. 13 - Prob. 6PCh. 13 - Prob. 7PCh. 13 - What can we conclude about a mutational event...Ch. 13 - 9. In terms of the chromosome content of nuclei,...Ch. 13 - 10. In Drosophila, an X-linked recessive allele...
Ch. 13 - The plants in this problem are the same as those...Ch. 13 - A normal chromosome and its homolog carrying a...Ch. 13 - 10.12 A pair of homologous chromosomes in...Ch. 13 - 10.13 An animal heterozygous for a reciprocal...Ch. 13 - Dr. Ara B. Dopsis has an idea he thinks will be a...Ch. 13 - Suppose polymerase chain reaction (PCR) is used...Ch. 13 - Prob. 17PCh. 13 - A healthy couple with a history of three previous...Ch. 13 - A boy with Down syndrome (trisomy 21) has 46...Ch. 13 - Prob. 20PCh. 13 - 10.28 A small population of deer living on an...Ch. 13 - In humans that XX/XO mosaics, the phenotype is...Ch. 13 - 10.20 A plant breeder would like to develop the...Ch. 13 - In Drosophilia, seven partial deletion (1to7)...Ch. 13 - Two experimental varieties of strawberry are...Ch. 13 - 10.23 In the tomato, Solanum esculentum, tall ()...Ch. 13 - In Drosophila, the wild-type red eye color is...Ch. 13 - A DrosophilaPelement 2.5kb in length is modified...Ch. 13 - A biologist studying flight mechanisms in insects...Ch. 13 - 30. After reading Experimental Insight and...Ch. 13 - 31. Two NotI restriction enzymes cleave DNA on...Ch. 13 - For the following crosses, determine as accurately...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A rare dominant mutation expressed at birth was studiedin humans. Records showed that six cases were discoveredin 40,000 live births. Family histories revealed that in twocases, the mutation was already present in one of the parents.Calculate the spontaneous mutation rate for this mutation.What are some underlying assumptions that may affect ourconclusions?arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardWhat phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation would have.arrow_forward
- Why is the p53 R273W mutation preventing p53 from binding to DNA?arrow_forwardDescribe the mutation that occurs in the following examples (be specific, if possible): BOAT to BAT SOAP to SOUP PAY to PLAY GCTCT to GCACT TGCCC to TACCC CATGC to GATGC TATATA to TACATAarrow_forwardIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forward
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardAfter treating cells with a chemical mutagen, youisolate two mutants. One carries alanine and the othercarries methionine at a site in the protein that normallycontains valine (Figure Q6–4). After treating these twomutants again with the mutagen, you isolate mutants fromeach that now carry threonine at the site of the originalvaline (Figure Q6–4). Assuming that all mutations involvesingle-nucleotide changes, deduce the codons that areused for valine, methionine, threonine, and alanine at theaffected site. Would you expect to be able to isolate valine-to-threonine mutants in one step?arrow_forwardWhat happens when a nonsense mutation is introduced into a transposon's gene encoding transposase? Only use 1-4 sentences to explain.arrow_forward
- Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.arrow_forwardBriefly explain the frameshift mutation ?arrow_forwardAmong the different types of amino acid substitution (same sense, missense, or nonsense mutations), which is the most deleterious one?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY